diff --git a/.editorconfig b/.editorconfig
index 89dd3564..44cb1a23 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -25,14 +25,14 @@ insert_final_newline = unset
 trim_trailing_whitespace = unset
 indent_style = unset
 
-# These files are edited and tested upstream in pfr/modules
-[/modules/pfr/**]
+# These files are edited and tested upstream in gallvp/modules
+[/modules/gallvp/**]
 charset = unset
 end_of_line = unset
 insert_final_newline = unset
 trim_trailing_whitespace = unset
 indent_style = unset
-[/subworkflows/pfr/**]
+[/subworkflows/gallvp/**]
 charset = unset
 end_of_line = unset
 insert_final_newline = unset
diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md
index b8059542..79b1aa06 100644
--- a/.github/CONTRIBUTING.md
+++ b/.github/CONTRIBUTING.md
@@ -52,9 +52,9 @@ These tests are run both with the latest available version of `Nextflow` and als
 
 :warning: Only in the unlikely and regretful event of a release happening with a bug.
 
-- On your own fork, make a new branch `patch` based on `upstream/master`.
+- On your own fork, make a new branch `patch` based on `upstream/main`.
 - Fix the bug, and bump version (X.Y.Z+1).
-- A PR should be made on `master` from patch to directly this particular bug.
+- A PR should be made on `main` from patch to directly this particular bug.
 
 ## Pipeline contribution conventions
 
diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md
index 3da295ca..0cd29f73 100644
--- a/.github/PULL_REQUEST_TEMPLATE.md
+++ b/.github/PULL_REQUEST_TEMPLATE.md
@@ -8,14 +8,14 @@ These are the most common things requested on pull requests (PRs).
 
 Remember that PRs should be made against the dev branch, unless you're preparing a pipeline release.
 
-Learn more about contributing: [CONTRIBUTING.md](https://github.com/plant-food-research-open/assemblyqc/tree/master/.github/CONTRIBUTING.md)
+Learn more about contributing: [CONTRIBUTING.md](https://github.com/plant-food-research-open/assemblyqc/tree/main/.github/CONTRIBUTING.md)
 -->
 
 ## PR checklist
 
 - [ ] This comment contains a description of changes (with reason).
 - [ ] If you've fixed a bug or added code that should be tested, add tests!
-- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/plant-food-research-open/assemblyqc/tree/master/.github/CONTRIBUTING.md)
+- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/plant-food-research-open/assemblyqc/tree/main/.github/CONTRIBUTING.md)
 - [ ] Make sure your code lints (`nf-core lint`).
 - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir <OUTDIR>`).
 - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir <OUTDIR>`).
diff --git a/.github/check_module_versions.py b/.github/check_module_versions.py
new file mode 100755
index 00000000..fe039efc
--- /dev/null
+++ b/.github/check_module_versions.py
@@ -0,0 +1,321 @@
+#!/usr/bin/env python3
+
+import colorlog
+from urllib.parse import quote_plus
+from functools import cmp_to_key
+from pathlib import Path
+
+import subprocess
+import argparse
+import requests
+import logging
+import semver
+import json
+import re
+import os
+
+PIPELINE_REPO = "plant-food-research-open/assemblyqc"
+
+
+def get_logger():
+    formatter = colorlog.ColoredFormatter(
+        "%(log_color)s%(levelname)-8s%(reset)s %(blue)s%(message)s",
+        datefmt=None,
+        reset=True,
+        log_colors={
+            "DEBUG": "cyan",
+            "INFO": "green",
+            "WARNING": "yellow",
+            "ERROR": "red",
+            "CRITICAL": "red,bg_white",
+        },
+        secondary_log_colors={},
+        style="%",
+    )
+
+    handler = colorlog.StreamHandler()
+    handler.setFormatter(formatter)
+
+    logger = colorlog.getLogger("")
+    logger.addHandler(handler)
+    return logger
+
+
+LOGGER = get_logger()
+
+
+def first(from_list):
+    if from_list == []:
+        return None
+
+    return from_list[0]
+
+
+def extract_semvar(from_version_str):
+    version_numbers = first(
+        re.findall(r"^[vV]?(\d+)\.?(\d*)\.?(\d*)$", from_version_str)
+    )
+    if version_numbers == None:
+        return None
+
+    major_ver = int(version_numbers[0])
+    minor_ver = int(f"{version_numbers[1]}") if version_numbers[1] != "" else 0
+    patch_ver = int(f"{version_numbers[2]}") if version_numbers[2] != "" else 0
+
+    return f"{major_ver}.{minor_ver}.{patch_ver}"
+
+
+def check_version_status(git_repo_from_meta):
+
+    host = git_repo_from_meta["host"]
+    org = git_repo_from_meta["org"]
+    repo = git_repo_from_meta["repo"]
+    current_ver = git_repo_from_meta["semver"]
+
+    sem_versions = []
+    if host == "github":
+        r = subprocess.run(
+            " ".join(
+                [
+                    "gh api",
+                    '-H "Accept: application/vnd.github+json"',
+                    '-H "X-GitHub-Api-Version: 2022-11-28"',
+                    f"/repos/{org}/{repo}/tags",
+                ]
+            ),
+            shell=True,
+            capture_output=True,
+            text=True,
+        )
+
+        if r.returncode != 0:
+            LOGGER.warning(f"Failed to get tags for {org}/{repo}: {r.stderr}")
+            return None
+
+        response_data = json.loads(r.stdout)
+
+    elif host == "gitlab":
+        encoded = quote_plus(f"{org}/{repo}")
+        r = requests.get(
+            f"https://gitlab.com/api/v4/projects/{encoded}/repository/tags"
+        )
+
+        if r.status_code != 200:
+            LOGGER.warning(f"Failed to get tags for {org}/{repo}: {r.json()}")
+            return None
+        response_data = r.json()
+
+    else:
+        raise f"{host} is not supported!"
+
+    available_versions = [x["name"] for x in response_data]
+
+    if available_versions == []:
+        LOGGER.warning(f"No versions available for {host}/{org}/{repo}")
+        return None
+
+    LOGGER.debug(f"Available versions for {host}/{org}/{repo}: {available_versions}")
+
+    sem_versions = [extract_semvar(x["name"]) for x in response_data]
+    sem_versions = [v for v in sem_versions if v != None]
+    if sem_versions == []:
+        LOGGER.warning(f"{host}/{org}/{repo} versions do not conform to semver")
+        return None
+
+    newer_vers = [v for v in sem_versions if semver.compare(v, current_ver) > 0]
+
+    if newer_vers == []:
+        LOGGER.info(
+            f"{host}/{org}/{repo} does not have a new version compared to {current_ver}, first/last {available_versions[0]}/{available_versions[-1]}"
+        )
+        return None
+
+    latest_version = max(newer_vers, key=cmp_to_key(semver.compare))
+
+    LOGGER.info(
+        f"{host}/{org}/{repo} has a new version {latest_version} compared to {current_ver}"
+    )
+
+    return {**git_repo_from_meta, "latest_version": latest_version}
+
+
+def get_new_versions_from_meta_paths():
+
+    module_meta_paths = (
+        subprocess.run(
+            "find ./modules -name meta.yml",
+            shell=True,
+            capture_output=True,
+            text=True,
+        )
+        .stdout.strip()
+        .split("\n")
+    )
+
+    git_repos_from_meta = []
+    for meta_path in module_meta_paths:
+        meta_text = Path(meta_path).read_text()
+        main_path = f"{os.path.dirname(meta_path)}/main.nf"
+        main_text = Path(main_path).read_text()
+        repo = first(
+            re.findall(
+                r"\s+tool_dev_url:\s+\"?https://(github|gitlab).com/([\w-]+)/([\w-]+)\"?",
+                meta_text,
+            )
+        )
+
+        if repo == None:
+            LOGGER.warning(f"No repo found in {meta_path}")
+            continue
+
+        LOGGER.debug(f"{meta_path} repo: {repo}")
+
+        if "mulled-v2" in main_text:
+            LOGGER.warning(f"Mulled container found in {main_path}")
+            continue
+
+        version = first(re.findall(rf".*/([\w-]+):v?([\.0-9]+)", main_text))
+
+        if version == None:
+            LOGGER.warning(f"No version found in {main_path}")
+            continue
+
+        LOGGER.debug(f"{main_path} version: {version}")
+
+        semver_version = extract_semvar(version[1])
+
+        if semver_version == None:
+            LOGGER.warning(
+                f"Version {version} from {main_path} does not conform to semver"
+            )
+            continue
+
+        repo_data = {
+            "meta.yml": meta_path,
+            "main.nf": main_path,
+            "host": repo[0],
+            "org": repo[1],
+            "repo": repo[2],
+            "tool": version[0],
+            "semver": semver_version,
+        }
+
+        LOGGER.debug(f"{meta_path} version data: {repo_data}")
+
+        git_repos_from_meta.append(repo_data)
+
+    with_latest = [check_version_status(r) for r in git_repos_from_meta]
+    filtered = [v for v in with_latest if v != None]
+    grouped = {}
+
+    for v in filtered:
+        key = f"{v['host']}/{v['org']}/{v['repo']}"
+        if key not in grouped.keys():
+            grouped[key] = {}
+            grouped[key]["latest_version"] = v["latest_version"]
+            grouped[key]["modules"] = []
+            grouped[key]["modules"].append(v)
+            continue
+
+        grouped[key]["modules"].append(v)
+        grouped[key]["latest_version"] = semver.max_ver(
+            grouped[key]["latest_version"], v["latest_version"]
+        )
+
+    return grouped
+
+
+def get_repo_issue_titles(repo):
+    r = subprocess.run(
+        " ".join(
+            [
+                "gh api",
+                '-H "Accept: application/vnd.github+json"',
+                '-H "X-GitHub-Api-Version: 2022-11-28"',
+                f"/repos/{repo}/issues",
+            ]
+        ),
+        shell=True,
+        capture_output=True,
+        text=True,
+    )
+
+    if r.returncode != 0:
+        LOGGER.error(f"Failed to get issues for {repo}: {r.stderr}")
+        exit(1)
+
+    response_data = json.loads(r.stdout)
+
+    update_issues = [
+        x["title"] for x in response_data if x["title"].startswith("[UPDATE]")
+    ]
+
+    return update_issues
+
+
+def register_issue(host_repo_name, issue_title, tool_data):
+
+    first_module = tool_data["modules"][0]
+    host, org, repo = (first_module["host"], first_module["org"], first_module["repo"])
+
+    module_paths = "\n".join(
+        [f"- {module['main.nf']}" for module in tool_data["modules"]]
+    )
+
+    issue_data = [
+        "gh api",
+        "--method POST",
+        '-H "Accept: application/vnd.github+json"',
+        '-H "X-GitHub-Api-Version: 2022-11-28"',
+        f"/repos/{host_repo_name}/issues",
+        f'-f "title={issue_title}"',
+        f'-f "body=- https://{host}.com/{org}/{repo}\n{module_paths}"',
+        '-f "labels[]=enhancement"',
+    ]
+
+    issue_post = subprocess.run(
+        " ".join(issue_data),
+        shell=True,
+        capture_output=True,
+        text=True,
+    )
+
+    if issue_post.returncode == 0:
+        LOGGER.info(f"Submitted issue: {issue_title}")
+    else:
+        LOGGER.warning(f"Failed to submitted issue: {issue_title}: {issue_post.stderr}")
+
+
+if __name__ == "__main__":
+
+    parser = argparse.ArgumentParser()
+
+    parser.add_argument(
+        "-v", "--verbose", action="store_true", help="Enable verbose mode"
+    )
+    parser.add_argument(
+        "-d", "--dry-run", action="store_true", help="Enable dry-run mode"
+    )
+    args = parser.parse_args()
+
+    if args.verbose:
+        LOGGER.setLevel(level=logging.DEBUG)
+    else:
+        LOGGER.setLevel(level=logging.INFO)
+
+    git_repos_from_meta = get_new_versions_from_meta_paths()
+    update_issue_titles = get_repo_issue_titles(PIPELINE_REPO)
+
+    for key, tool_data in git_repos_from_meta.items():
+
+        new_issue_title = f"[UPDATE] {key.upper()} -> {tool_data['latest_version']}"
+
+        if new_issue_title in update_issue_titles:
+            LOGGER.info(f"{new_issue_title} has already been raised!")
+            continue
+
+        if args.dry_run:
+            LOGGER.info(f"Dry run new issue: {new_issue_title}")
+            continue
+
+        register_issue(PIPELINE_REPO, new_issue_title, tool_data)
diff --git a/docs/contributors.sh b/.github/contributors.sh
similarity index 100%
rename from docs/contributors.sh
rename to .github/contributors.sh
diff --git a/version_check.sh b/.github/version_checks.sh
similarity index 76%
rename from version_check.sh
rename to .github/version_checks.sh
index ca34d57e..23cf619c 100755
--- a/version_check.sh
+++ b/.github/version_checks.sh
@@ -12,8 +12,3 @@ fi
 
 head -10 CHANGELOG.md | grep "## v$config_version - " >/dev/null \
     || (echo 'Failed to match CHANGELOG version'; exit 1)
-
-# Check README version
-
-grep "assembly quality ($config_version)" README.md >/dev/null \
-    || (echo 'Failed to match README version'; exit 1)
diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml
index 9186934e..4bfbab63 100644
--- a/.github/workflows/branch.yml
+++ b/.github/workflows/branch.yml
@@ -1,15 +1,15 @@
 name: nf-core branch protection
-# This workflow is triggered on PRs to master branch on the repository
-# It fails when someone tries to make a PR against the nf-core `master` branch instead of `dev`
+# This workflow is triggered on PRs to main branch on the repository
+# It fails when someone tries to make a PR against the nf-core `main` branch instead of `dev`
 on:
   pull_request_target:
-    branches: [master]
+    branches: [main]
 
 jobs:
   test:
     runs-on: ubuntu-latest
     steps:
-      # PRs to the nf-core repo master branch are only ok if coming from the nf-core repo `dev` or any `patch` branches
+      # PRs to the nf-core repo main branch are only ok if coming from the nf-core repo `dev` or any `patch` branches
       - name: Check PRs
         if: github.repository == 'plant-food-research-open/assemblyqc'
         run: |
@@ -22,7 +22,7 @@ jobs:
         uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2
         with:
           message: |
-            ## This PR is against the `master` branch :x:
+            ## This PR is against the `main` branch :x:
 
             * Do not close this PR
             * Click _Edit_ and change the `base` to `dev`
@@ -32,9 +32,9 @@ jobs:
 
             Hi @${{ github.event.pull_request.user.login }},
 
-            It looks like this pull-request is has been made against the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `master` branch.
-            The `master` branch on nf-core repositories should always contain code from the latest release.
-            Because of this, PRs to `master` are only allowed if they come from the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `dev` branch.
+            It looks like this pull-request is has been made against the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `main` branch.
+            The `main` branch on nf-core repositories should always contain code from the latest release.
+            Because of this, PRs to `main` are only allowed if they come from the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `dev` branch.
 
             You do not need to close this PR, you can change the target branch to `dev` by clicking the _"Edit"_ button at the top of this page.
             Note that even after this, the test will continue to show as failing until you push a new commit.
diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
index 89f347df..715ae17c 100644
--- a/.github/workflows/ci.yml
+++ b/.github/workflows/ci.yml
@@ -29,6 +29,7 @@ jobs:
           - minimal
           - invalid
           - stub
+          - noltr
         include:
           - OPTION_STUB: ""
           - OPTION_STUB: "-stub"
diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml
index 2d20d644..4a2e3eb4 100644
--- a/.github/workflows/download_pipeline.yml
+++ b/.github/workflows/download_pipeline.yml
@@ -2,7 +2,7 @@ name: Test successful pipeline download with 'nf-core download'
 
 # Run the workflow when:
 #  - dispatched manually
-#  - when a PR is opened or reopened to master branch
+#  - when a PR is opened or reopened to main branch
 #  - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev.
 on:
   workflow_dispatch:
@@ -17,10 +17,10 @@ on:
       - edited
       - synchronize
     branches:
-      - master
+      - main
   pull_request_target:
     branches:
-      - master
+      - main
 
 env:
   NXF_ANSI_LOG: false
diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml
index 05605419..1fcafe88 100644
--- a/.github/workflows/linting.yml
+++ b/.github/workflows/linting.yml
@@ -51,26 +51,7 @@ jobs:
           GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }}
           GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
           GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }}
-        run: |
-          nf-core -l lint_log.txt lint \
-            --dir ${GITHUB_WORKSPACE} \
-            --markdown lint_results.md \
-            --key actions_ci \
-            --key actions_schema_validation \
-            --key base_config \
-            --key files_exist \
-            --key files_unchanged \
-            --key merge_markers \
-            --key modules_config \
-            --key nextflow_config \
-            --key nfcore_yml \
-            --key pipeline_name_conventions \
-            --key pipeline_todos \
-            --key readme \
-            --key schema_description \
-            --key schema_lint \
-            --key schema_params \
-            --key system_exit
+        run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md
 
       - name: Save PR number
         if: ${{ always() }}
diff --git a/.nf-core.yml b/.nf-core.yml
index 87685f2a..0ade11e9 100644
--- a/.nf-core.yml
+++ b/.nf-core.yml
@@ -10,17 +10,15 @@ lint:
     - assets/multiqc_config.yml
     - conf/igenomes.config
   files_unchanged:
-    - CODE_OF_CONDUCT.md
-    - assets/nf-core-assemblyqc_logo_light.png
-    - docs/images/nf-core-assemblyqc_logo_light.png
-    - docs/images/nf-core-assemblyqc_logo_dark.png
     - docs/README.md
+    - .github/PULL_REQUEST_TEMPLATE.md
     - .github/CONTRIBUTING.md
-    - .github/workflows/linting.yml
+    - .github/workflows/branch.yml
     - LICENSE
   nextflow_config:
     - manifest.name
     - manifest.homePage
+  multiqc_config: False
   template_strings: False
 nf_core_version: 2.14.1
 repository_type: pipeline
diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml
index 9b0780ba..1168e07f 100644
--- a/.pre-commit-config.yaml
+++ b/.pre-commit-config.yaml
@@ -17,7 +17,7 @@ repos:
         name: Version checks
         language: system
         entry: >
-          ./version_check.sh
+          .github/version_checks.sh
         always_run: true
         fail_fast: true
         pass_filenames: false
diff --git a/CHANGELOG.md b/CHANGELOG.md
index 9ae1f69e..99cc4b45 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -3,6 +3,45 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
+## v2.1.0 - [31-July-2024]
+
+### `Added`
+
+1. Created summary presence/absence tables for NCBI FCS modules [#88](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/88)
+2. Added min. system requirements [#91](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/91)
+3. Added a test to verify the fix for the bug which resulted in a pipeline crash for assemblies without LTRs
+4. Updated NCBI FCS GX to 0.5.4 [#93](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/93)
+5. Updated `SYRI` to 1.7.0 [#104](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/104)
+6. Added a script to automatically check for updates on GitHub/GitLab and post issues
+7. Updated modules: `UNTAR`, `MERYL_COUNT`, `GUNZIP`, `MINIMAP2_ALIGN`, `FASTQC`
+
+### `Fixed`
+
+1. Fixed a bug where `intron_length_distribution` was used instead of `cds_length_distribution` when creating the CDS Length Distribution Graph [#95](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/95)
+2. Fixed a bug where 'Subsequent pipeline modules are skipped.' was printed in the `report.html` even when `contamination_stops_pipeline` was set to false
+3. Now NCBI FCS GX module uses all the cores available from the Nextflow task
+4. Fixed a bug which caused `PLOTSR` to fail for certain assembly names [#102](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/102)
+5. Now `LTRRETRIEVER_LTRRETRIEVER` does not crash when the input assembly does not contain any LTRs [#92](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/92)
+6. Now `LTRRETRIEVER_LTRRETRIEVER` does not crash when the input assembly is not writable [#98](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/98)
+7. Now soft masked regions are unmasked before computing LAI [#117](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/117)
+8. Fixed a bug in `ASSEMBLATHON_STATS` which caused it to fail on MMC executor due to multiple binds of the `bin` directory
+9. Changed `NextFlow` to `Nextflow`
+10. Updated citation to Bioinformatics
+
+### `Dependencies`
+
+1. Nextflow!>=23.04.0
+2. nf-validation@1.1.3
+
+### `Deprecated`
+
+1. Changed default branch name from `master` to `main` in nf-core template files
+2. Moved `version_check.sh` to `.github/version_checks.sh`
+3. Moved `docs/contributors.sh` to `.github/contributors.sh`
+4. Removed dependency on <https://github.com/PlantandFoodResearch/nxf-modules.git>
+5. Replaced `nf-core/fastq_trim_fastp_fastqc` with `nf-core/fastq_fastqc_umitools_fastp` which has nf-test unit tests
+6. Removed version check on README.md
+
 ## v2.0.0 - [04-June-2024]
 
 ### `Added`
@@ -37,11 +76,11 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 8. Updated `FASTA_LTRRETRIEVER_LAI` to fix a pipeline crash when `ch_monoploid_seqs` was `[ meta, [] ]` [#83](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/83)
 9. Improved input assembly documentation [#86](https://github.com/Plant-Food-Research-Open/assemblyqc/issues/86)
 10. Added assembly tag to synteny warning message regarding missing `synteny_labels` file
-11. Now copying files in `NCBI_FCS_GX_SETUP_SAMPLE` rather than symlinking in an attempt to support NextFlow Fusion
+11. Now copying files in `NCBI_FCS_GX_SETUP_SAMPLE` rather than symlinking in an attempt to support Nextflow Fusion
 
 ### `Dependencies`
 
-1. NextFlow!>=23.04.0
+1. Nextflow!>=23.04.0
 2. nf-validation@1.1.3
 
 ### `Deprecated`
@@ -80,7 +119,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 
 ### `Dependencies`
 
-1. NextFlow!>=23.04.0
+1. Nextflow!>=23.04.0
 2. nf-validation@1.1.3
 
 ### `Deprecated`
@@ -130,7 +169,7 @@ For a ~600 MB assembly, EDTA (without sensitive flag) takes ~25 hours of compute
 ## v1.0.1 [07-Sep-2023]
 
 1. Now pipeline timeline, report, and trace are enabled by default.
-2. Included `procps` package where needed to allow NextFlow to collect system statistics.
+2. Included `procps` package where needed to allow Nextflow to collect system statistics.
 
 ## v1 [25-Jul-2023]
 
@@ -222,7 +261,7 @@ Same as v1rc6c
 
 ## v0.10.4 [16-May-2023]
 
-1. Moved the main workflow into `workflows/assembly_qc.nf` so that it can be imported by other NextFlow pipelines.
+1. Moved the main workflow into `workflows/assembly_qc.nf` so that it can be imported by other Nextflow pipelines.
 2. Fixed a bug in synteny due to which the pipeline did not resume properly sometimes.
 3. The included binaries now have unique versions to avoid collision with binaries with same names already present on local PATH.
 4. Now using a unique name for the conda environment to have better interoperability across pipelines.
diff --git a/CITATION.cff b/CITATION.cff
index 23125eae..63044f81 100644
--- a/CITATION.cff
+++ b/CITATION.cff
@@ -16,12 +16,16 @@ authors:
     given-names: "Marcus"
   - family-names: "Chen"
     given-names: "Ting-Hsuan"
+  - family-names: "Carvajal"
+    given-names: "Ignacio"
+  - family-names: "Bailey"
+    given-names: "Sarah"
   - family-names: "Thomson"
     given-names: "Susan"
   - family-names: "Deng"
     given-names: "Cecilia"
-title: "AssemblyQC: A NextFlow pipeline for evaluating assembly quality"
-version: 2.0.0
-date-released: 2024-02-12
-url: "https://github.com/Plant-Food-Research-Open/assembly_qc"
-doi: 10.5281/zenodo.10647870
+title: "AssemblyQC: A Nextflow pipeline for reproducible reporting of assembly quality"
+version: 2.1.0
+date-released: 2024-07-30
+url: "https://github.com/Plant-Food-Research-Open/assemblyqc"
+doi: 10.1093/bioinformatics/btae477
diff --git a/README.md b/README.md
index 74f56c0d..3ae86dfa 100644
--- a/README.md
+++ b/README.md
@@ -1,5 +1,5 @@
 [![GitHub Actions CI Status](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/ci.yml/badge.svg)](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/ci.yml)
-[![GitHub Actions Linting Status](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/linting.yml/badge.svg)](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/linting.yml)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.10647870-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.10647870)
+[![GitHub Actions Linting Status](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/linting.yml/badge.svg)](https://github.com/plant-food-research-open/assemblyqc/actions/workflows/linting.yml)[![Cite Article](http://img.shields.io/badge/DOI-10.1093/bioinformatics/btae477-1073c8?labelColor=000000)](https://doi.org/10.1093/bioinformatics/btae477)
 [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)
 
 [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
@@ -10,7 +10,7 @@
 
 ## Introduction
 
-**plant-food-research-open/assemblyqc** is a [NextFlow](https://www.nextflow.io/docs/latest/index.html) pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report. The tools are shown in the [Pipeline Flowchart](#pipeline-flowchart) and their references are listed in [CITATIONS.md](./CITATIONS.md).
+**plant-food-research-open/assemblyqc** is a [Nextflow](https://www.nextflow.io/docs/latest/index.html) pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report. The tools are shown in the [Pipeline Flowchart](#pipeline-flowchart) and their references are listed in [CITATIONS.md](./CITATIONS.md).
 
 ## Pipeline Flowchart
 
@@ -123,7 +123,7 @@ plant-food-research-open/assemblyqc was originally written by Usman Rashid ([@ga
 
 Ross Crowhurst ([@rosscrowhurst](https://github.com/rosscrowhurst)), Chen Wu ([@christinawu2008](https://github.com/christinawu2008)) and Marcus Davy ([@mdavy86](https://github.com/mdavy86)) generously contributed their QC scripts.
 
-Mahesh Binzer-Panchal ([@mahesh-panchal](https://github.com/mahesh-panchal)) helped port the pipeline modules and sub-workflows to [nf-core](https://nf-co.re) schema.
+Mahesh Binzer-Panchal ([@mahesh-panchal](https://github.com/mahesh-panchal)) and Simon Pearce ([@SPPearce](https://github.com/SPPearce)) helped port the pipeline modules and sub-workflows to [nf-core](https://nf-co.re) schema.
 
 We thank the following people for their extensive assistance in the development of this pipeline:
 
@@ -145,20 +145,21 @@ The pipeline uses nf-core modules contributed by following authors:
 <a href="https://github.com/maxulysse"><img src="https://github.com/maxulysse.png" width="50" height="50"></a>
 <a href="https://github.com/matthdsm"><img src="https://github.com/matthdsm.png" width="50" height="50"></a>
 <a href="https://github.com/joseespinosa"><img src="https://github.com/joseespinosa.png" width="50" height="50"></a>
+<a href="https://github.com/grst"><img src="https://github.com/grst.png" width="50" height="50"></a>
 <a href="https://github.com/ewels"><img src="https://github.com/ewels.png" width="50" height="50"></a>
 <a href="https://github.com/sofstam"><img src="https://github.com/sofstam.png" width="50" height="50"></a>
 <a href="https://github.com/sateeshperi"><img src="https://github.com/sateeshperi.png" width="50" height="50"></a>
+<a href="https://github.com/robsyme"><img src="https://github.com/robsyme.png" width="50" height="50"></a>
 <a href="https://github.com/priyanka-surana"><img src="https://github.com/priyanka-surana.png" width="50" height="50"></a>
 <a href="https://github.com/phue"><img src="https://github.com/phue.png" width="50" height="50"></a>
 <a href="https://github.com/muffato"><img src="https://github.com/muffato.png" width="50" height="50"></a>
 <a href="https://github.com/lescai"><img src="https://github.com/lescai.png" width="50" height="50"></a>
 <a href="https://github.com/kevinmenden"><img src="https://github.com/kevinmenden.png" width="50" height="50"></a>
 <a href="https://github.com/jvhagey"><img src="https://github.com/jvhagey.png" width="50" height="50"></a>
-<a href="https://github.com/joon-klaps"><img src="https://github.com/joon-klaps.png" width="50" height="50"></a>
 <a href="https://github.com/jeremy1805"><img src="https://github.com/jeremy1805.png" width="50" height="50"></a>
 <a href="https://github.com/heuermh"><img src="https://github.com/heuermh.png" width="50" height="50"></a>
-<a href="https://github.com/grst"><img src="https://github.com/grst.png" width="50" height="50"></a>
 <a href="https://github.com/friederikehanssen"><img src="https://github.com/friederikehanssen.png" width="50" height="50"></a>
+<a href="https://github.com/fellen31"><img src="https://github.com/fellen31.png" width="50" height="50"></a>
 <a href="https://github.com/felixkrueger"><img src="https://github.com/felixkrueger.png" width="50" height="50"></a>
 <a href="https://github.com/erikrikarddaniel"><img src="https://github.com/erikrikarddaniel.png" width="50" height="50"></a>
 <a href="https://github.com/edmundmiller"><img src="https://github.com/edmundmiller.png" width="50" height="50"></a>
@@ -173,7 +174,11 @@ If you would like to contribute to this pipeline, please see the [contributing g
 
 If you use plant-food-research-open/assemblyqc for your analysis, please cite it as:
 
-> Rashid, U., Wu, C., Shiller, J., Smith, K., Crowhurst, R., Davy, M., Chen, T.-H., Thomson, S., & Deng, C. (2024). AssemblyQC: A NextFlow pipeline for evaluating assembly quality (2.0.0). Zenodo. https://doi.org/10.5281/zenodo.10647870
+> **AssemblyQC: A Nextflow pipeline for reproducible reporting of assembly quality.**
+>
+> Usman Rashid, Chen Wu, Jason Shiller, Ken Smith, Ross Crowhurst, Marcus Davy, Ting-Hsuan Chen, Ignacio Carvajal, Sarah Bailey, Susan Thomson & Cecilia H Deng.
+>
+> _Bioinformatics_. 2024 July 30. doi: [10.1093/bioinformatics/btae477](https://doi.org/10.1093/bioinformatics/btae477).
 
 An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.
 
diff --git a/assets/email_template.html b/assets/email_template.html
index 5a56215f..672f3f2a 100644
--- a/assets/email_template.html
+++ b/assets/email_template.html
@@ -4,7 +4,7 @@
   <meta http-equiv="X-UA-Compatible" content="IE=edge">
   <meta name="viewport" content="width=device-width, initial-scale=1">
 
-  <meta name="description" content="plant-food-research-open/assemblyqc: A NextFlow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.">
+  <meta name="description" content="plant-food-research-open/assemblyqc: A Nextflow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.">
   <title>plant-food-research-open/assemblyqc Pipeline Report</title>
 </head>
 <body>
diff --git a/assets/schema_input.json b/assets/schema_input.json
index f415c25e..afec8fe7 100644
--- a/assets/schema_input.json
+++ b/assets/schema_input.json
@@ -1,6 +1,6 @@
 {
     "$schema": "http://json-schema.org/draft-07/schema",
-    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/master/assets/schema_input.json",
+    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/main/assets/schema_input.json",
     "title": "plant-food-research-open/assemblyqc pipeline - params.input schema",
     "description": "Schema for the file provided with params.input",
     "type": "array",
diff --git a/assets/schema_xref_assemblies.json b/assets/schema_xref_assemblies.json
index 47ea1ed0..0da6ca1c 100644
--- a/assets/schema_xref_assemblies.json
+++ b/assets/schema_xref_assemblies.json
@@ -1,6 +1,6 @@
 {
     "$schema": "http://json-schema.org/draft-07/schema",
-    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/master/assets/schema_xref_assemblies.json",
+    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/main/assets/schema_xref_assemblies.json",
     "title": "plant-food-research-open/assemblyqc pipeline - params.synteny_xref_assemblies schema",
     "description": "Schema for the file provided with params.synteny_xref_assemblies",
     "type": "array",
diff --git a/bin/report_modules/parsers/genometools_gt_stat_parser.py b/bin/report_modules/parsers/genometools_gt_stat_parser.py
index a4e4e6f4..ddc3bb95 100644
--- a/bin/report_modules/parsers/genometools_gt_stat_parser.py
+++ b/bin/report_modules/parsers/genometools_gt_stat_parser.py
@@ -82,7 +82,7 @@ def parse_genometools_gt_stat_folder(folder_name="genometools_gt_stat"):
         cds_length_distribution_graph = ""
         if cds_length_distribution != []:
             cds_length_distribution_graph = create_dist_graph(
-                intron_length_distribution,
+                cds_length_distribution,
                 "Length",
                 "CDS Length Distribution",
                 f"./{folder_name}/{os.path.basename(report_path)}.cds.length.png",
diff --git a/bin/report_modules/parsers/lai_parser.py b/bin/report_modules/parsers/lai_parser.py
index 7318e92a..eac49a85 100644
--- a/bin/report_modules/parsers/lai_parser.py
+++ b/bin/report_modules/parsers/lai_parser.py
@@ -92,4 +92,28 @@ def parse_lai_folder(folder_name="lai_outputs"):
         }
         data["LAI"].append(stats)
 
+    list_of_ltrretriever_log_files = lai_folder_path.glob("*.log")
+
+    for file in list_of_ltrretriever_log_files:
+        if str(file).endswith("LAI.log"):
+            continue
+
+        p = re.compile("ERROR: (.*)")
+        match_results = p.findall(file.read_text())
+        if len(match_results) < 1:
+            continue
+
+        file_tokens = re.findall(
+            r"([\w]+).log",
+            os.path.basename(str(file)),
+        )
+
+        hap_name = file_tokens[0]
+
+        stats = {
+            "hap": hap_name,
+            "result": f"<b style='color:red;'>LTR_retriever Error:</b> {match_results[0]}".strip(),
+        }
+        data["LAI"].append(stats)
+
     return {"LAI": sort_list_of_results(data["LAI"], "hap")}
diff --git a/bin/report_modules/templates/lai/lai.html b/bin/report_modules/templates/lai/lai.html
index 50a98582..34c5ccd8 100644
--- a/bin/report_modules/templates/lai/lai.html
+++ b/bin/report_modules/templates/lai/lai.html
@@ -14,7 +14,9 @@
             Nucleic Acids Research, Volume 46, Issue 21, 30 November 2018, Page e126,
             <a href="https://doi.org/10.1093/nar/gky730" target="_blank">10.1093/nar/gky730</a>
         </p>
+        {% if 'LTRRETRIEVER_LAI' in all_stats_dicts['VERSIONS'] %}
         <p class="section-para"><b>Version: {{ all_stats_dicts['VERSIONS']['LTRRETRIEVER_LAI']['lai'] }}</b></p>
+        {% endif %}
     </div>
     {% include 'lai/dropdown.html' %} {% include 'lai/summary_contents.html' %}
 </div>
diff --git a/bin/report_modules/templates/ncbi_fcs_adaptor/dropdown.html b/bin/report_modules/templates/ncbi_fcs_adaptor/dropdown.html
index 9f21bc26..fda13538 100644
--- a/bin/report_modules/templates/ncbi_fcs_adaptor/dropdown.html
+++ b/bin/report_modules/templates/ncbi_fcs_adaptor/dropdown.html
@@ -1,6 +1,7 @@
 <div class="dropdown">
     <div class="dropdown_content">
         <select id="selector_NCBI_FCS_ADAPTOR" onchange="showContent('NCBI_FCS_ADAPTOR')">
+          <option value="summary_NCBI_FCS_ADAPTOR">Summary</option>
             {% set str_hap = 'hap' %} {% for item in range(all_stats_dicts["NCBI_FCS_ADAPTOR"]|length) %}
             <option value="tabcontent_NCBI_FCS_ADAPTOR_{{all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['hap']}}">
                 {{ all_stats_dicts['NCBI_FCS_ADAPTOR'][item][str_hap] }} {% endfor %}
diff --git a/bin/report_modules/templates/ncbi_fcs_adaptor/ncbi_fcs_adaptor.html b/bin/report_modules/templates/ncbi_fcs_adaptor/ncbi_fcs_adaptor.html
index 4c95333f..a74e2174 100644
--- a/bin/report_modules/templates/ncbi_fcs_adaptor/ncbi_fcs_adaptor.html
+++ b/bin/report_modules/templates/ncbi_fcs_adaptor/ncbi_fcs_adaptor.html
@@ -7,5 +7,7 @@
         </p>
         <p class="section-para"><b>Version: {{ all_stats_dicts['VERSIONS']['FCS_FCSADAPTOR']['FCS-adaptor'] }}</b></p>
     </div>
-    {% include 'ncbi_fcs_adaptor/dropdown.html' %} {% include 'ncbi_fcs_adaptor/report_contents.html' %}
+    {% include 'ncbi_fcs_adaptor/dropdown.html' %}
+    {% include 'ncbi_fcs_adaptor/summary_contents.html' %}
+    {% include 'ncbi_fcs_adaptor/report_contents.html' %}
 </div>
diff --git a/bin/report_modules/templates/ncbi_fcs_adaptor/report_contents.html b/bin/report_modules/templates/ncbi_fcs_adaptor/report_contents.html
index ae1cd77b..ff1290aa 100644
--- a/bin/report_modules/templates/ncbi_fcs_adaptor/report_contents.html
+++ b/bin/report_modules/templates/ncbi_fcs_adaptor/report_contents.html
@@ -1,9 +1,8 @@
-{% set vars = {'is_first': True} %} {% for item in range(all_stats_dicts["NCBI_FCS_ADAPTOR"]|length) %} {% set
-active_text = 'display: block' if vars.is_first else 'display: none' %}
+{% for item in range(all_stats_dicts["NCBI_FCS_ADAPTOR"]|length) %}
 <div
     id="tabcontent_NCBI_FCS_ADAPTOR_{{ all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['hap'] }}"
     class="tabcontent-NCBI_FCS_ADAPTOR"
-    style="{{ active_text }}"
+    style="display: none"
 >
     <div class="results-section">
         <div class="section-heading-wrapper">
@@ -12,7 +11,7 @@
     </div>
     {%if all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['did_detect_contamination'] %}
     <div class="section-para-wrapper">
-        <p class="section-para">Contamination detected. Subsequent pipeline modules are skipped.</p>
+        <p class="section-para">Contamination detected.{%if all_stats_dicts['PARAMS_DICT']['contamination_stops_pipeline'] %} Subsequent pipeline modules are skipped.{% endif %}</p>
     </div>
     <div class="table-outer">
         <div class="table-wrapper">{{ all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['report_table_html'] }}</div>
@@ -21,4 +20,4 @@
     <div class="section-para-wrapper"><p class="section-para">No contamination detected.</p></div>
     {% endif %}
 </div>
-{% if vars.update({'is_first': False}) %} {% endif %} {% endfor %}
+{% endfor %}
diff --git a/bin/report_modules/templates/ncbi_fcs_adaptor/summary_contents.html b/bin/report_modules/templates/ncbi_fcs_adaptor/summary_contents.html
new file mode 100644
index 00000000..4a8af40d
--- /dev/null
+++ b/bin/report_modules/templates/ncbi_fcs_adaptor/summary_contents.html
@@ -0,0 +1,32 @@
+<div id="summary_NCBI_FCS_ADAPTOR" class="tabcontent-NCBI_FCS_ADAPTOR" style="display: block">
+    <div class="results-section">
+        <div class="section-heading-wrapper">
+            <div class="section-heading">Summary</div>
+        </div>
+
+        <div class="table-outer">
+            <div class="table-wrapper">
+                <table>
+                    <thead>
+                        <tr>
+                            <th width="20%" style="text-align: left">Assembly</th>
+                            <th width="80%" style="text-align: left">Contaminated?</th>
+                        </tr>
+                    </thead>
+                    <tbody>
+                        {% for item in range(all_stats_dicts["NCBI_FCS_ADAPTOR"]|length) %}
+                        <tr>
+                            <td style="text-align: left; font-size: 16px">
+                                {{ all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['hap'] }}
+                            </td>
+                            <td style="text-align: left; font-size: 16px">
+                              {%if all_stats_dicts['NCBI_FCS_ADAPTOR'][item]['did_detect_contamination'] %}<b style="color: red;">Yes!</b>{% else %}No{% endif %}
+                            </td>
+                        </tr>
+                        {% endfor %}
+                    </tbody>
+                </table>
+            </div>
+        </div>
+    </div>
+</div>
diff --git a/bin/report_modules/templates/ncbi_fcs_gx/dropdown.html b/bin/report_modules/templates/ncbi_fcs_gx/dropdown.html
index 594f3e6f..05a55c20 100644
--- a/bin/report_modules/templates/ncbi_fcs_gx/dropdown.html
+++ b/bin/report_modules/templates/ncbi_fcs_gx/dropdown.html
@@ -1,6 +1,7 @@
 <div class="dropdown">
     <div class="dropdown_content">
         <select id="selector_NCBI_FCS_GX" onchange="showContent('NCBI_FCS_GX')">
+            <option value="summary_NCBI_FCS_GX">Summary</option>
             {% set str_hap = 'hap' %} {% for item in range(all_stats_dicts["NCBI_FCS_GX"]|length) %}
             <option value="tabcontent_NCBI_FCS_GX_{{all_stats_dicts['NCBI_FCS_GX'][item]['hap']}}">
                 {{ all_stats_dicts['NCBI_FCS_GX'][item][str_hap] }} {% endfor %}
diff --git a/bin/report_modules/templates/ncbi_fcs_gx/ncbi_fcs_gx.html b/bin/report_modules/templates/ncbi_fcs_gx/ncbi_fcs_gx.html
index e2c2a338..fecca37e 100644
--- a/bin/report_modules/templates/ncbi_fcs_gx/ncbi_fcs_gx.html
+++ b/bin/report_modules/templates/ncbi_fcs_gx/ncbi_fcs_gx.html
@@ -16,8 +16,8 @@
         <p class="section-para">
             <b>DB Version: {{ all_stats_dicts['NCBI_FCS_GX'][0]['report_meta_data'][1]['db']['build-date'] }}</b>
         </p>
-
-        <p></p>
     </div>
-    {% include 'ncbi_fcs_gx/dropdown.html' %} {% include 'ncbi_fcs_gx/report_contents.html' %}
+    {% include 'ncbi_fcs_gx/dropdown.html' %}
+    {% include 'ncbi_fcs_gx/summary_contents.html' %}
+    {% include 'ncbi_fcs_gx/report_contents.html' %}
 </div>
diff --git a/bin/report_modules/templates/ncbi_fcs_gx/report_contents.html b/bin/report_modules/templates/ncbi_fcs_gx/report_contents.html
index c99c5622..a7d6f27d 100644
--- a/bin/report_modules/templates/ncbi_fcs_gx/report_contents.html
+++ b/bin/report_modules/templates/ncbi_fcs_gx/report_contents.html
@@ -1,9 +1,8 @@
-{% set vars = {'is_first': True} %} {% for item in range(all_stats_dicts["NCBI_FCS_GX"]|length) %} {% set active_text =
-'display: block' if vars.is_first else 'display: none' %}
+{% for item in range(all_stats_dicts["NCBI_FCS_GX"]|length) %}
 <div
     id="tabcontent_NCBI_FCS_GX_{{ all_stats_dicts['NCBI_FCS_GX'][item]['hap'] }}"
     class="tabcontent-NCBI_FCS_GX"
-    style="{{ active_text }}"
+    style="display: none"
 >
     <div class="results-section">
         <div class="section-heading-wrapper">
@@ -11,7 +10,7 @@
         </div>
         {%if all_stats_dicts['NCBI_FCS_GX'][item]['did_detect_contamination'] %}
         <div class="section-para-wrapper">
-            <p class="section-para">Contamination detected. Subsequent pipeline modules are skipped.</p>
+            <p class="section-para">Contamination detected.{%if all_stats_dicts['PARAMS_DICT']['contamination_stops_pipeline'] %} Subsequent pipeline modules are skipped.{% endif %}</p>
         </div>
         <div class="table-outer">
             <div class="table-wrapper">{{ all_stats_dicts['NCBI_FCS_GX'][item]['report_table_html'] }}</div>
@@ -46,4 +45,4 @@
         </div>
     </div>
 </div>
-{% if vars.update({'is_first': False}) %} {% endif %} {% endfor %}
+{% endfor %}
diff --git a/bin/report_modules/templates/ncbi_fcs_gx/summary_contents.html b/bin/report_modules/templates/ncbi_fcs_gx/summary_contents.html
new file mode 100644
index 00000000..706a6d5d
--- /dev/null
+++ b/bin/report_modules/templates/ncbi_fcs_gx/summary_contents.html
@@ -0,0 +1,32 @@
+<div id="summary_NCBI_FCS_GX" class="tabcontent-NCBI_FCS_GX" style="display: block">
+    <div class="results-section">
+        <div class="section-heading-wrapper">
+            <div class="section-heading">Summary</div>
+        </div>
+
+        <div class="table-outer">
+            <div class="table-wrapper">
+                <table>
+                    <thead>
+                        <tr>
+                            <th width="20%" style="text-align: left">Assembly</th>
+                            <th width="80%" style="text-align: left">Contaminated?</th>
+                        </tr>
+                    </thead>
+                    <tbody>
+                        {% for item in range(all_stats_dicts["NCBI_FCS_GX"]|length) %}
+                        <tr>
+                            <td style="text-align: left; font-size: 16px">
+                                {{ all_stats_dicts['NCBI_FCS_GX'][item]['hap'] }}
+                            </td>
+                            <td style="text-align: left; font-size: 16px">
+                              {%if all_stats_dicts['NCBI_FCS_GX'][item]['did_detect_contamination'] %}<b style="color: red;">Yes!</b>{% else %}No{% endif %}
+                            </td>
+                        </tr>
+                        {% endfor %}
+                    </tbody>
+                </table>
+            </div>
+        </div>
+    </div>
+</div>
diff --git a/bin/report_modules/templates/params/params.html b/bin/report_modules/templates/params/params.html
index 70452246..4d37d9b6 100644
--- a/bin/report_modules/templates/params/params.html
+++ b/bin/report_modules/templates/params/params.html
@@ -1,19 +1,18 @@
 <div id="PARAMS" class="tabcontent" style="display: none">
-    <div class="section-para-wrapper">
-        <p class="section-para">
-            AssemblyQC is a Nextflow pipeline which evaluates assembly quality with well established tools and presents
-            the results in a unified html report.
-        </p>
-        <p class="section-para"><b>Reference:</b></p>
-        <p class="section-para">
-            Rashid, U., Wu, C., Shiller, J., Smith, K., Crowhurst, R., Davy, M., Chen, T.-H., Thomson, S., & Deng, C.
-            (2024). AssemblyQC: A NextFlow pipeline for evaluating assembly quality ({{
-            all_stats_dicts['VERSIONS']['Workflow']['plant-food-research-open/assemblyqc'] }}). Zenodo.
-            <a href="https://doi.org/10.5281/zenodo.10647870" target="_blank">10.5281/zenodo.10647870</a>. GitHub.
-            <a href="https://github.com/Plant-Food-Research-Open/assemblyqc" target="_blank"
-                >https://github.com/Plant-Food-Research-Open/assemblyqc</a
-            >
-        </p>
-    </div>
-    {% include 'params/contents.html' %}
+  <div class="section-para-wrapper">
+    <p class="section-para">
+      AssemblyQC is a Nextflow pipeline which evaluates assembly quality with well established tools and presents
+      the results in a unified html report.
+    </p>
+    <p class="section-para"><b>Reference:</b></p>
+    <p class="section-para">
+      Rashid, U., Wu, C., Shiller, J., Smith, K., Crowhurst, R., Davy, M., Chen, T.-H., Carvajal, I., Bailey, S.,
+      Thomson, S., & Deng, C.H.
+      (2024). AssemblyQC: A Nextflow pipeline for reproducible reporting of assembly quality. Bioinformatics.
+      DOI <a href="https://doi.org/10.1093/bioinformatics/btae477" target="_blank">10.1093/bioinformatics/btae477</a>.
+      GitHub <a href="https://github.com/Plant-Food-Research-Open/assemblyqc"
+        target="_blank">https://github.com/Plant-Food-Research-Open/assemblyqc</a>.
+    </p>
+  </div>
+  {% include 'params/contents.html' %}
 </div>
diff --git a/conf/modules.config b/conf/modules.config
index 42bd196d..5f857db6 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -234,6 +234,10 @@ process {
         ]
     }
 
+    withName: '.*:FASTA_LTRRETRIEVER_LAI:UNMASK_IF_ANY' {
+        ext.args = '-u'
+    }
+
     withName: CUSTOM_SHORTENFASTAIDS {
         publishDir = [
             path: { "${params.outdir}/lai" },
@@ -278,7 +282,7 @@ process {
         ]
     }
 
-    withName: FASTQC_RAW {
+    withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW' {
         publishDir = [
             path: { "${params.outdir}/hic/fastqc_raw" },
             mode: params.publish_dir_mode,
@@ -286,7 +290,7 @@ process {
         ]
     }
 
-    withName: FASTQC_TRIM {
+    withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_TRIM' {
         publishDir = [
             path: { "${params.outdir}/hic/fastqc_trim" },
             mode: params.publish_dir_mode,
@@ -294,7 +298,7 @@ process {
         ]
     }
 
-    withName: FASTP {
+    withName: '.*:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP' {
         ext.args = params.hic_fastp_ext_args
         publishDir = [
             path: { "${params.outdir}/hic/fastp" },
diff --git a/docs/output.md b/docs/output.md
index b1cbf180..ae9e7f75 100644
--- a/docs/output.md
+++ b/docs/output.md
@@ -138,6 +138,9 @@ TIDK toolkit is designed to [identify and visualize](https://github.com/tolkit/t
 
 LTR Assembly Index (LAI) is a reference-free genome metric that [evaluates assembly continuity](https://doi.org/10.1093/nar/gky730) using LTR-RTs. LTR retrotransposons (LTR-RTs) are the predominant interspersed repeat that is poorly assembled in draft genomes. Correcting for LTR-RT amplification dynamics, LAI is independent of genome size, genomic LTR-RT content, and gene space evaluation metrics such as BUSCO. LAI = Raw LAI + 2.8138 × (94 – whole genome LTR identity). The LAI is set to 0 when raw LAI = 0 or the adjustment produces a negative value. Raw LAI = (Intact LTR element length / Total LTR sequence length) \* 100
 
+> [!WARNING]
+> Soft masked regions are unmasked when calculating LAI. However, hard masked regions are left as is. The pipeline will fail to calculate LAI if all the LTRs are already hard masked.
+
 ### Kraken2
 
 <details markdown="1">
diff --git a/docs/parameters.md b/docs/parameters.md
index 3b763b7c..d99bb66d 100644
--- a/docs/parameters.md
+++ b/docs/parameters.md
@@ -1,6 +1,6 @@
 # plant-food-research-open/assemblyqc pipeline parameters
 
-A NextFlow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.
+A Nextflow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.
 
 ## Input/output options
 
diff --git a/docs/usage.md b/docs/usage.md
index 8399a19c..82117eb5 100644
--- a/docs/usage.md
+++ b/docs/usage.md
@@ -1,4 +1,34 @@
-# plant-food-research-open/assemblyqc: Usage
+# plant-food-research-open/assemblyqc: Usage<!-- omit in toc -->
+
+- [Assemblysheet input](#assemblysheet-input)
+- [External databases](#external-databases)
+  - [NCBI FCS GX database](#ncbi-fcs-gx-database)
+  - [Kraken2](#kraken2)
+  - [BUSCO](#busco)
+- [Other parameters](#other-parameters)
+  - [Assemblathon stats](#assemblathon-stats)
+  - [NCBI FCS GX](#ncbi-fcs-gx)
+  - [BUSCO](#busco-1)
+  - [TIDK](#tidk)
+  - [HiC](#hic)
+  - [Synteny analysis](#synteny-analysis)
+  - [Merqury K-mer analysis](#merqury-k-mer-analysis)
+- [Minimum System Requirements](#minimum-system-requirements)
+- [Running the pipeline](#running-the-pipeline)
+  - [Updating the pipeline](#updating-the-pipeline)
+  - [Reproducibility](#reproducibility)
+- [Core Nextflow arguments](#core-nextflow-arguments)
+  - [`-profile`](#-profile)
+  - [`-resume`](#-resume)
+  - [`-c`](#-c)
+- [Custom configuration](#custom-configuration)
+  - [Resource requests](#resource-requests)
+  - [Custom Containers](#custom-containers)
+  - [Custom Tool Arguments](#custom-tool-arguments)
+  - [nf-core/configs](#nf-coreconfigs)
+- [Azure Resource Requests](#azure-resource-requests)
+- [Running in the background](#running-in-the-background)
+- [Nextflow memory requirements](#nextflow-memory-requirements)
 
 ## Assemblysheet input
 
@@ -7,7 +37,7 @@ You will need to create an assemblysheet with information about the assemblies y
 - `tag:` A unique tag which represents the target assembly throughout the pipeline and in the final report. The `tag` and `fasta` file name should not be same, such as `tag.fasta`. This can create file name collisions in the pipeline or result in file overwrite. It is also a good-practice to make all the input files read-only.
 - `fasta:` FASTA file
 - `gff3 [Optional]:` GFF3 annotation file if available
-- `monoploid_ids [Optional]:` A txt file listing the sequence IDs used to calculate LAI in monoploid mode if necessary. If the intent is to run LAI against all the sequences in an assembly, this file can be skipped for that assembly. Soft masked regions are ignored when calculating LAI. The pipeline may fail if all the LTRs are already soft masked.
+- `monoploid_ids [Optional]:` A txt file listing the sequence IDs used to calculate LAI in monoploid mode if necessary. If the intent is to run LAI against all the sequences in an assembly, this file can be skipped for that assembly. Soft masked regions are unmasked when calculating LAI. However, hard masked regions are left as is. The pipeline will fail to calculate LAI if all the LTRs are already hard masked.
 - `synteny_labels [Optional]:` A two column tsv file listing fasta sequence IDs (first column) and their labels for the synteny plots (second column) when performing synteny analysis. If a sequence ID is missing from this file, the corresponding sequence is excluded from the analysis. If `synteny_labels` is not provided for an assembly, that assembly is excluded from the analysis.
 
 See the [Merqury](#merqury-k-mer-analysis) section For description of assemblysheet columns related to k-mer analysis with Merqury.
@@ -95,6 +125,13 @@ See following assemblysheet examples for MERQURY analysis.
 
 The data for these examples comes from: [umd.edu](https://obj.umiacs.umd.edu/marbl_publications/triobinning/index.html)
 
+## Minimum System Requirements
+
+All the modules have been tested to work on a single machine with 10 CPUs + 30 GBs of memory, except NCBI FCS GX and Kraken2. Their minimum requirements are:
+
+- NCBI FCS GX: 1 CPU + 512 GBs memory
+- Kraken2: 1 CPU + 200 GBs memory
+
 ## Running the pipeline
 
 The typical command for running the pipeline is as follows:
diff --git a/modules.json b/modules.json
index c0c4132a..eaf1e089 100644
--- a/modules.json
+++ b/modules.json
@@ -2,136 +2,136 @@
     "name": "plant-food-research-open/assemblyqc",
     "homePage": "https://github.com/plant-food-research-open/assemblyqc",
     "repos": {
-        "https://github.com/PlantandFoodResearch/nxf-modules.git": {
+        "https://github.com/GallVp/nxf-components.git": {
             "modules": {
-                "pfr": {
+                "gallvp": {
                     "busco/busco": {
                         "branch": "main",
-                        "git_sha": "c3ef9317fe867609f5927588fbf17e3c3ebf389c",
+                        "git_sha": "ab92c438688c1f4a3753b65914bfd2e6319cebb2",
                         "installed_by": ["fasta_gxf_busco_plot"]
                     },
                     "busco/generateplot": {
                         "branch": "main",
-                        "git_sha": "c3ef9317fe867609f5927588fbf17e3c3ebf389c",
+                        "git_sha": "ab92c438688c1f4a3753b65914bfd2e6319cebb2",
                         "installed_by": ["fasta_gxf_busco_plot"]
                     },
                     "bwa/index": {
                         "branch": "main",
-                        "git_sha": "d158062346649b5d55bccef77f4bbd0468760aff",
+                        "git_sha": "3cba9e138cf07f2db778a7ad6aae0ab707948c74",
                         "installed_by": ["fastq_bwa_mem_samblaster"]
                     },
                     "bwa/mem": {
                         "branch": "main",
-                        "git_sha": "d158062346649b5d55bccef77f4bbd0468760aff",
+                        "git_sha": "3cba9e138cf07f2db778a7ad6aae0ab707948c74",
                         "installed_by": ["fastq_bwa_mem_samblaster"]
                     },
                     "cat/cat": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "custom/relabelfasta": {
                         "branch": "main",
-                        "git_sha": "0421bdeb1d7a71dce12e0af7dc18aea26e548074",
+                        "git_sha": "775762619b57101ca800269b6ecda0b915fb9913",
                         "installed_by": ["modules"]
                     },
                     "custom/restoregffids": {
                         "branch": "main",
-                        "git_sha": "da7a50af5eaac9601e23f33e00bf24e61f9c27ab",
+                        "git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "custom/shortenfastaids": {
                         "branch": "main",
-                        "git_sha": "e9ec2e4c48ead3d760c8e13950c568c19ae86b8b",
+                        "git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "gffread": {
                         "branch": "main",
-                        "git_sha": "c3ef9317fe867609f5927588fbf17e3c3ebf389c",
+                        "git_sha": "c04bf39d67027e044a6eaed0b7b0439fd8866fc7",
                         "installed_by": ["fasta_gxf_busco_plot"]
                     },
                     "gt/gff3": {
                         "branch": "main",
-                        "git_sha": "84f31d4be03e2ae6bee8e0b9fdea466be8e997bb",
+                        "git_sha": "c68acf8c8993f85be6e417d0db1bbf3a919f9226",
                         "installed_by": ["gff3_gt_gff3_gff3validator_stat"]
                     },
                     "gt/gff3validator": {
                         "branch": "main",
-                        "git_sha": "84f31d4be03e2ae6bee8e0b9fdea466be8e997bb",
+                        "git_sha": "49bbf276b8aeda94bf69a982cdb6d68d7dc5ea4e",
                         "installed_by": ["gff3_gt_gff3_gff3validator_stat"]
                     },
                     "gt/stat": {
                         "branch": "main",
-                        "git_sha": "ffd39a616c84c814fdfb2a865e9fbbb06e5343d9",
-                        "installed_by": ["gff3_gt_gff3_gff3validator_stat", "modules"]
+                        "git_sha": "c68acf8c8993f85be6e417d0db1bbf3a919f9226",
+                        "installed_by": ["gff3_gt_gff3_gff3validator_stat"]
                     },
                     "ltrfinder": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "db7fb043c5557cf06a49a1edbed16e282a7dffb2",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "ltrharvest": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "db7fb043c5557cf06a49a1edbed16e282a7dffb2",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "ltrretriever/lai": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
                     "ltrretriever/ltrretriever": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "490f8ab54c632d84f99edd6f208305ac5e283ab3",
                         "installed_by": ["fasta_ltrretriever_lai"]
                     },
-                    "merqury/hapmers": {
-                        "branch": "main",
-                        "git_sha": "46b70684b6ae0ac60cae154c61796b293707db64",
-                        "installed_by": ["modules"]
-                    },
                     "plotsr": {
                         "branch": "main",
-                        "git_sha": "0413d9b25b127f1c705349fb42de8ff54e83e1e9",
+                        "git_sha": "665454056d9cc2a1e1a392505ca8bf975ae1b711",
                         "installed_by": ["modules"]
                     },
                     "samblaster": {
                         "branch": "main",
-                        "git_sha": "10b046eaac396f279c08e7e2bb067482ccd9c74e",
+                        "git_sha": "53518187fb1f596f4779da061cd35ce9f973c06e",
                         "installed_by": ["fastq_bwa_mem_samblaster"]
                     },
                     "samtools/faidx": {
                         "branch": "main",
-                        "git_sha": "84f31d4be03e2ae6bee8e0b9fdea466be8e997bb",
+                        "git_sha": "c68acf8c8993f85be6e417d0db1bbf3a919f9226",
                         "installed_by": ["gff3_gt_gff3_gff3validator_stat"]
                     },
+                    "seqkit/seq": {
+                        "branch": "main",
+                        "git_sha": "8ec55a2c8e4ce3af070393768f6c2c57f5c34076",
+                        "installed_by": ["fasta_ltrretriever_lai"]
+                    },
                     "syri": {
                         "branch": "main",
-                        "git_sha": "295e1d8666c746cb05e79563393035e81c9739fc",
+                        "git_sha": "836bb223521eeaa08d65c1b7f4b82be1272a1964",
                         "installed_by": ["modules"]
                     }
                 }
             },
             "subworkflows": {
-                "pfr": {
+                "gallvp": {
                     "fasta_gxf_busco_plot": {
                         "branch": "main",
-                        "git_sha": "0e4afaff4964485d2d93f1115c5254a99765b9c1",
+                        "git_sha": "7bf6fbca23edc94490ffa6709f52b2f71c6fb130",
                         "installed_by": ["subworkflows"]
                     },
                     "fasta_ltrretriever_lai": {
                         "branch": "main",
-                        "git_sha": "e9ec2e4c48ead3d760c8e13950c568c19ae86b8b",
+                        "git_sha": "8ec55a2c8e4ce3af070393768f6c2c57f5c34076",
                         "installed_by": ["subworkflows"]
                     },
                     "fastq_bwa_mem_samblaster": {
                         "branch": "main",
-                        "git_sha": "d158062346649b5d55bccef77f4bbd0468760aff",
+                        "git_sha": "775762619b57101ca800269b6ecda0b915fb9913",
                         "installed_by": ["subworkflows"]
                     },
                     "gff3_gt_gff3_gff3validator_stat": {
                         "branch": "main",
-                        "git_sha": "84f31d4be03e2ae6bee8e0b9fdea466be8e997bb",
+                        "git_sha": "775762619b57101ca800269b6ecda0b915fb9913",
                         "installed_by": ["subworkflows"]
                     }
                 }
@@ -152,13 +152,13 @@
                     },
                     "fastp": {
                         "branch": "master",
-                        "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080",
-                        "installed_by": ["fastq_trim_fastp_fastqc"]
+                        "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
+                        "installed_by": ["fastq_fastqc_umitools_fastp"]
                     },
                     "fastqc": {
                         "branch": "master",
-                        "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd",
-                        "installed_by": ["fastq_trim_fastp_fastqc"]
+                        "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
+                        "installed_by": ["fastq_fastqc_umitools_fastp"]
                     },
                     "fcs/fcsadaptor": {
                         "branch": "master",
@@ -167,7 +167,12 @@
                     },
                     "gunzip": {
                         "branch": "master",
-                        "git_sha": "3a5fef109d113b4997c9822198664ca5f2716208",
+                        "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
+                        "installed_by": ["modules"]
+                    },
+                    "merqury/hapmers": {
+                        "branch": "master",
+                        "git_sha": "deadc7dfc8cd06aee6ab133df43242212ae1f8fb",
                         "installed_by": ["modules"]
                     },
                     "merqury/merqury": {
@@ -177,7 +182,7 @@
                     },
                     "meryl/count": {
                         "branch": "master",
-                        "git_sha": "1c72d95476a2edf92ee4f08dc4321b3c50cd3c13",
+                        "git_sha": "2910aa889fd3497727d87854148a0e0aa1105da3",
                         "installed_by": ["modules"]
                     },
                     "meryl/unionsum": {
@@ -187,7 +192,7 @@
                     },
                     "minimap2/align": {
                         "branch": "master",
-                        "git_sha": "72e277acfd9e61a9f1368eafb4a9e83f5bcaa9f5",
+                        "git_sha": "a33ef9475558c6b8da08c5f522ddaca1ec810306",
                         "installed_by": ["modules"]
                     },
                     "seqkit/rmdup": {
@@ -198,7 +203,7 @@
                     "seqkit/seq": {
                         "branch": "master",
                         "git_sha": "2be41ca2cc780eca4293d1b0dd3850b0b7ac40a3",
-                        "installed_by": ["fasta_explore_search_plot_tidk"]
+                        "installed_by": ["fasta_explore_search_plot_tidk", "fasta_ltrretriever_lai"]
                     },
                     "seqkit/sort": {
                         "branch": "master",
@@ -230,9 +235,14 @@
                         "git_sha": "669a329f4aa37f5b7f03776c2ed1cd0ef122c626",
                         "installed_by": ["fasta_explore_search_plot_tidk"]
                     },
+                    "umitools/extract": {
+                        "branch": "master",
+                        "git_sha": "b4919e9a2b4d8b71061e601633db4600a3858fa1",
+                        "installed_by": ["fastq_fastqc_umitools_fastp"]
+                    },
                     "untar": {
                         "branch": "master",
-                        "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa",
+                        "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
                         "installed_by": ["modules"]
                     }
                 }
@@ -249,9 +259,9 @@
                         "git_sha": "1fc29f92e439d5631fdf34b8ac4687297d70f5ec",
                         "installed_by": ["subworkflows"]
                     },
-                    "fastq_trim_fastp_fastqc": {
+                    "fastq_fastqc_umitools_fastp": {
                         "branch": "master",
-                        "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f",
+                        "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
                         "installed_by": ["subworkflows"]
                     },
                     "utils_nextflow_pipeline": {
diff --git a/modules/pfr/busco/busco/environment.yml b/modules/gallvp/busco/busco/environment.yml
similarity index 100%
rename from modules/pfr/busco/busco/environment.yml
rename to modules/gallvp/busco/busco/environment.yml
diff --git a/modules/pfr/busco/busco/main.nf b/modules/gallvp/busco/busco/main.nf
similarity index 100%
rename from modules/pfr/busco/busco/main.nf
rename to modules/gallvp/busco/busco/main.nf
diff --git a/modules/pfr/busco/busco/meta.yml b/modules/gallvp/busco/busco/meta.yml
similarity index 100%
rename from modules/pfr/busco/busco/meta.yml
rename to modules/gallvp/busco/busco/meta.yml
diff --git a/modules/pfr/busco/busco/tests/main.nf.test b/modules/gallvp/busco/busco/tests/main.nf.test
similarity index 91%
rename from modules/pfr/busco/busco/tests/main.nf.test
rename to modules/gallvp/busco/busco/tests/main.nf.test
index 16b708b2..829bd285 100644
--- a/modules/pfr/busco/busco/tests/main.nf.test
+++ b/modules/gallvp/busco/busco/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "BUSCO_BUSCO"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "busco"
     tag "busco/busco"
 
@@ -18,7 +18,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                 ]
                 input[1] = 'genome'
                 input[2] = 'bacteria_odb10' // Launch with 'auto' to use --auto-lineage, and specified lineages // 'auto' removed from test due to memory issues
@@ -80,8 +80,8 @@ nextflow_process {
                 input[0] = [
                     [ id:'test' ], // meta map
                     [
-                        file( params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true),
-                        file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['genome_fasta'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/genome.fasta', checkIfExists: true)
                     ]
                 ]
                 input[1] = 'genome'
@@ -165,7 +165,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = 'genome'
                 input[2] = 'eukaryota_odb10'
@@ -208,8 +208,6 @@ nextflow_process {
 
             with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) {
                 assert contains('DEBUG:busco.run_BUSCO')
-                assert contains("'use_augustus', 'False'")
-                assert contains("'use_metaeuk', 'True'") // METAEUK
                 assert contains('Results from dataset')
                 assert contains('how to cite BUSCO')
 
@@ -230,7 +228,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = 'genome'
                 input[2] = 'eukaryota_odb10'
@@ -250,8 +248,6 @@ nextflow_process {
 
             with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) {
                 assert contains('DEBUG:busco.run_BUSCO')
-                assert contains("'use_augustus', 'True'")
-                assert contains("'use_metaeuk', 'False'") // AUGUSTUS
                 assert contains('Augustus did not recognize any genes')
 
             }
@@ -275,7 +271,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['proteome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/proteome.fasta', checkIfExists: true)
                 ]
                 input[1] = 'proteins'
                 input[2] = 'bacteria_odb10'
@@ -337,7 +333,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['bacteroides_fragilis']['illumina']['test1_contigs_fa_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/illumina/fasta/test1.contigs.fa.gz', checkIfExists: true)
                 ]
                 input[1] = 'transcriptome'
                 input[2] = 'bacteria_odb10'
@@ -398,7 +394,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file( params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                 ]
                 input[1] = 'genome'
                 input[2] = 'bacteria_odb10'
diff --git a/modules/pfr/busco/busco/tests/main.nf.test.snap b/modules/gallvp/busco/busco/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/busco/busco/tests/main.nf.test.snap
rename to modules/gallvp/busco/busco/tests/main.nf.test.snap
diff --git a/modules/pfr/busco/busco/tests/nextflow.augustus.config b/modules/gallvp/busco/busco/tests/nextflow.augustus.config
similarity index 100%
rename from modules/pfr/busco/busco/tests/nextflow.augustus.config
rename to modules/gallvp/busco/busco/tests/nextflow.augustus.config
diff --git a/modules/pfr/busco/busco/tests/nextflow.config b/modules/gallvp/busco/busco/tests/nextflow.config
similarity index 100%
rename from modules/pfr/busco/busco/tests/nextflow.config
rename to modules/gallvp/busco/busco/tests/nextflow.config
diff --git a/modules/pfr/busco/busco/tests/nextflow.metaeuk.config b/modules/gallvp/busco/busco/tests/nextflow.metaeuk.config
similarity index 100%
rename from modules/pfr/busco/busco/tests/nextflow.metaeuk.config
rename to modules/gallvp/busco/busco/tests/nextflow.metaeuk.config
diff --git a/modules/pfr/busco/busco/tests/old_test.yml b/modules/gallvp/busco/busco/tests/old_test.yml
similarity index 100%
rename from modules/pfr/busco/busco/tests/old_test.yml
rename to modules/gallvp/busco/busco/tests/old_test.yml
diff --git a/modules/pfr/busco/busco/tests/tags.yml b/modules/gallvp/busco/busco/tests/tags.yml
similarity index 100%
rename from modules/pfr/busco/busco/tests/tags.yml
rename to modules/gallvp/busco/busco/tests/tags.yml
diff --git a/modules/pfr/busco/generateplot/environment.yml b/modules/gallvp/busco/generateplot/environment.yml
similarity index 100%
rename from modules/pfr/busco/generateplot/environment.yml
rename to modules/gallvp/busco/generateplot/environment.yml
diff --git a/modules/pfr/busco/generateplot/main.nf b/modules/gallvp/busco/generateplot/main.nf
similarity index 100%
rename from modules/pfr/busco/generateplot/main.nf
rename to modules/gallvp/busco/generateplot/main.nf
diff --git a/modules/pfr/busco/generateplot/meta.yml b/modules/gallvp/busco/generateplot/meta.yml
similarity index 100%
rename from modules/pfr/busco/generateplot/meta.yml
rename to modules/gallvp/busco/generateplot/meta.yml
diff --git a/modules/pfr/busco/generateplot/tests/main.nf.test b/modules/gallvp/busco/generateplot/tests/main.nf.test
similarity index 82%
rename from modules/pfr/busco/generateplot/tests/main.nf.test
rename to modules/gallvp/busco/generateplot/tests/main.nf.test
index 853dc5ed..6a43fa73 100644
--- a/modules/pfr/busco/generateplot/tests/main.nf.test
+++ b/modules/gallvp/busco/generateplot/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "BUSCO_GENERATEPLOT"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "busco"
     tag "busco/busco"
     tag "busco/generateplot"
@@ -19,7 +19,7 @@ nextflow_process {
                     """
                     input[0] = [
                         [ id:'test' ], // meta map
-                        file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                     ]
                     input[1] = 'genome'
                     input[2] = 'bacteria_odb10'
@@ -55,7 +55,7 @@ nextflow_process {
         when {
             process {
                 """
-                input[0] = file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                input[0] = file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                 """
             }
         }
diff --git a/modules/pfr/busco/generateplot/tests/main.nf.test.snap b/modules/gallvp/busco/generateplot/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/busco/generateplot/tests/main.nf.test.snap
rename to modules/gallvp/busco/generateplot/tests/main.nf.test.snap
diff --git a/modules/pfr/busco/generateplot/tests/tags.yml b/modules/gallvp/busco/generateplot/tests/tags.yml
similarity index 100%
rename from modules/pfr/busco/generateplot/tests/tags.yml
rename to modules/gallvp/busco/generateplot/tests/tags.yml
diff --git a/modules/pfr/bwa/index/environment.yml b/modules/gallvp/bwa/index/environment.yml
similarity index 100%
rename from modules/pfr/bwa/index/environment.yml
rename to modules/gallvp/bwa/index/environment.yml
diff --git a/modules/pfr/bwa/index/main.nf b/modules/gallvp/bwa/index/main.nf
similarity index 100%
rename from modules/pfr/bwa/index/main.nf
rename to modules/gallvp/bwa/index/main.nf
diff --git a/modules/pfr/bwa/index/meta.yml b/modules/gallvp/bwa/index/meta.yml
similarity index 94%
rename from modules/pfr/bwa/index/meta.yml
rename to modules/gallvp/bwa/index/meta.yml
index 4c7d30f3..6bbc87a6 100644
--- a/modules/pfr/bwa/index/meta.yml
+++ b/modules/gallvp/bwa/index/meta.yml
@@ -11,7 +11,7 @@ tools:
         BWA is a software package for mapping DNA sequences against
         a large reference genome, such as the human genome.
       homepage: http://bio-bwa.sourceforge.net/
-      documentation: http://www.htslib.org/doc/samtools.html
+      documentation: https://bio-bwa.sourceforge.net/bwa.shtml
       arxiv: arXiv:1303.3997
       licence: ["GPL-3.0-or-later"]
 input:
diff --git a/modules/pfr/bwa/index/tests/main.nf.test b/modules/gallvp/bwa/index/tests/main.nf.test
similarity index 96%
rename from modules/pfr/bwa/index/tests/main.nf.test
rename to modules/gallvp/bwa/index/tests/main.nf.test
index af33e73c..6a3b3671 100644
--- a/modules/pfr/bwa/index/tests/main.nf.test
+++ b/modules/gallvp/bwa/index/tests/main.nf.test
@@ -1,7 +1,7 @@
 nextflow_process {
 
     name "Test Process BWA_INDEX"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "modules"
     tag "bwa"
     tag "bwa/index"
diff --git a/modules/pfr/bwa/index/tests/main.nf.test.snap b/modules/gallvp/bwa/index/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/bwa/index/tests/main.nf.test.snap
rename to modules/gallvp/bwa/index/tests/main.nf.test.snap
diff --git a/modules/pfr/bwa/index/tests/tags.yml b/modules/gallvp/bwa/index/tests/tags.yml
similarity index 100%
rename from modules/pfr/bwa/index/tests/tags.yml
rename to modules/gallvp/bwa/index/tests/tags.yml
diff --git a/modules/pfr/bwa/mem/environment.yml b/modules/gallvp/bwa/mem/environment.yml
similarity index 100%
rename from modules/pfr/bwa/mem/environment.yml
rename to modules/gallvp/bwa/mem/environment.yml
diff --git a/modules/pfr/bwa/mem/main.nf b/modules/gallvp/bwa/mem/main.nf
similarity index 100%
rename from modules/pfr/bwa/mem/main.nf
rename to modules/gallvp/bwa/mem/main.nf
diff --git a/modules/pfr/bwa/mem/meta.yml b/modules/gallvp/bwa/mem/meta.yml
similarity index 96%
rename from modules/pfr/bwa/mem/meta.yml
rename to modules/gallvp/bwa/mem/meta.yml
index 1532c261..b126dd86 100644
--- a/modules/pfr/bwa/mem/meta.yml
+++ b/modules/gallvp/bwa/mem/meta.yml
@@ -14,7 +14,7 @@ tools:
         BWA is a software package for mapping DNA sequences against
         a large reference genome, such as the human genome.
       homepage: http://bio-bwa.sourceforge.net/
-      documentation: http://www.htslib.org/doc/samtools.html
+      documentation: https://bio-bwa.sourceforge.net/bwa.shtml
       arxiv: arXiv:1303.3997
       licence: ["GPL-3.0-or-later"]
 input:
diff --git a/modules/pfr/bwa/mem/tests/main.nf.test b/modules/gallvp/bwa/mem/tests/main.nf.test
similarity index 99%
rename from modules/pfr/bwa/mem/tests/main.nf.test
rename to modules/gallvp/bwa/mem/tests/main.nf.test
index 463b76f8..a8f55e4f 100644
--- a/modules/pfr/bwa/mem/tests/main.nf.test
+++ b/modules/gallvp/bwa/mem/tests/main.nf.test
@@ -1,7 +1,7 @@
 nextflow_process {
 
     name "Test Process BWA_MEM"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "modules"
     tag "bwa"
     tag "bwa/mem"
diff --git a/modules/pfr/bwa/mem/tests/main.nf.test.snap b/modules/gallvp/bwa/mem/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/bwa/mem/tests/main.nf.test.snap
rename to modules/gallvp/bwa/mem/tests/main.nf.test.snap
diff --git a/modules/pfr/bwa/mem/tests/tags.yml b/modules/gallvp/bwa/mem/tests/tags.yml
similarity index 100%
rename from modules/pfr/bwa/mem/tests/tags.yml
rename to modules/gallvp/bwa/mem/tests/tags.yml
diff --git a/modules/pfr/cat/cat/environment.yml b/modules/gallvp/cat/cat/environment.yml
similarity index 100%
rename from modules/pfr/cat/cat/environment.yml
rename to modules/gallvp/cat/cat/environment.yml
diff --git a/modules/pfr/cat/cat/main.nf b/modules/gallvp/cat/cat/main.nf
similarity index 99%
rename from modules/pfr/cat/cat/main.nf
rename to modules/gallvp/cat/cat/main.nf
index adbdbd7b..2862c64c 100644
--- a/modules/pfr/cat/cat/main.nf
+++ b/modules/gallvp/cat/cat/main.nf
@@ -76,4 +76,3 @@ def getFileSuffix(filename) {
     def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/
     return match ? match[0][1] : filename.substring(filename.lastIndexOf('.'))
 }
-
diff --git a/modules/pfr/cat/cat/meta.yml b/modules/gallvp/cat/cat/meta.yml
similarity index 100%
rename from modules/pfr/cat/cat/meta.yml
rename to modules/gallvp/cat/cat/meta.yml
diff --git a/modules/pfr/cat/cat/tests/main.nf.test b/modules/gallvp/cat/cat/tests/main.nf.test
similarity index 88%
rename from modules/pfr/cat/cat/tests/main.nf.test
rename to modules/gallvp/cat/cat/tests/main.nf.test
index 0ac8549e..a0b9fd95 100644
--- a/modules/pfr/cat/cat/tests/main.nf.test
+++ b/modules/gallvp/cat/cat/tests/main.nf.test
@@ -4,7 +4,7 @@ nextflow_process {
     script "../main.nf"
     process "CAT_CAT"
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "cat"
     tag "cat/cat"
 
@@ -29,7 +29,8 @@ nextflow_process {
         then {
             assertAll(
                 { assert !process.success },
-                { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }
+                { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -83,8 +84,12 @@ nextflow_process {
             def lines = path(process.out.file_out.get(0).get(1)).linesGzip
             assertAll(
                 { assert process.success },
-                { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") },
-                { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")}
+                { assert snapshot(
+                    lines[0..5],
+                    lines.size(),
+                    process.out.versions
+                    ).match()
+                }
             )
         }
     }
@@ -142,8 +147,12 @@ nextflow_process {
             def lines = path(process.out.file_out.get(0).get(1)).linesGzip
             assertAll(
                 { assert process.success },
-                { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") },
-                { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")}
+                { assert snapshot(
+                    lines[0..5],
+                    lines.size(),
+                    process.out.versions
+                    ).match()
+                }
             )
         }
     }
@@ -170,9 +179,13 @@ nextflow_process {
             def lines = path(process.out.file_out.get(0).get(1)).linesGzip
             assertAll(
                 { assert process.success },
-                { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") },
-                { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")}
+                { assert snapshot(
+                    lines[0..5],
+                    lines.size(),
+                    process.out.versions
+                    ).match()
+                }
             )
         }
     }
-}
\ No newline at end of file
+}
diff --git a/modules/pfr/cat/cat/tests/main.nf.test.snap b/modules/gallvp/cat/cat/tests/main.nf.test.snap
similarity index 77%
rename from modules/pfr/cat/cat/tests/main.nf.test.snap
rename to modules/gallvp/cat/cat/tests/main.nf.test.snap
index 423571ba..b7623ee6 100644
--- a/modules/pfr/cat/cat/tests/main.nf.test.snap
+++ b/modules/gallvp/cat/cat/tests/main.nf.test.snap
@@ -1,10 +1,4 @@
 {
-    "test_cat_unzipped_zipped_size": {
-        "content": [
-            375
-        ],
-        "timestamp": "2023-10-16T14:33:08.049445686"
-    },
     "test_cat_unzipped_unzipped": {
         "content": [
             {
@@ -34,6 +28,10 @@
                 ]
             }
         ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
         "timestamp": "2023-10-16T14:32:18.500464399"
     },
     "test_cat_zipped_unzipped": {
@@ -65,9 +63,13 @@
                 ]
             }
         ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
         "timestamp": "2023-10-16T14:32:49.642741302"
     },
-    "test_cat_zipped_zipped_lines": {
+    "test_cat_zipped_zipped": {
         "content": [
             [
                 "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab",
@@ -76,11 +78,31 @@
                 "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
                 "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1",
                 "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1"
+            ],
+            78,
+            [
+                "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:51:46.802978"
+    },
+    "test_cat_name_conflict": {
+        "content": [
+            [
+                
             ]
         ],
-        "timestamp": "2023-10-16T14:32:33.629048645"
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:51:29.45394"
     },
-    "test_cat_unzipped_zipped_lines": {
+    "test_cat_one_file_unzipped_zipped": {
         "content": [
             [
                 ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
@@ -89,11 +111,19 @@
                 "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
                 "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
                 "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
+            ],
+            374,
+            [
+                "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
             ]
         ],
-        "timestamp": "2023-10-16T14:33:08.038830506"
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:52:02.774016"
     },
-    "test_cat_one_file_unzipped_zipped_lines": {
+    "test_cat_unzipped_zipped": {
         "content": [
             [
                 ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
@@ -102,20 +132,16 @@
                 "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
                 "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
                 "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
+            ],
+            375,
+            [
+                "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
             ]
         ],
-        "timestamp": "2023-10-16T14:33:21.39642399"
-    },
-    "test_cat_zipped_zipped_size": {
-        "content": [
-            78
-        ],
-        "timestamp": "2023-10-16T14:32:33.641869244"
-    },
-    "test_cat_one_file_unzipped_zipped_size": {
-        "content": [
-            374
-        ],
-        "timestamp": "2023-10-16T14:33:21.4094373"
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:51:57.581523"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/gallvp/cat/cat/tests/nextflow_unzipped_zipped.config
similarity index 100%
rename from modules/pfr/cat/cat/tests/nextflow_unzipped_zipped.config
rename to modules/gallvp/cat/cat/tests/nextflow_unzipped_zipped.config
diff --git a/modules/pfr/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/gallvp/cat/cat/tests/nextflow_zipped_unzipped.config
similarity index 100%
rename from modules/pfr/cat/cat/tests/nextflow_zipped_unzipped.config
rename to modules/gallvp/cat/cat/tests/nextflow_zipped_unzipped.config
diff --git a/modules/pfr/cat/cat/tests/tags.yml b/modules/gallvp/cat/cat/tests/tags.yml
similarity index 100%
rename from modules/pfr/cat/cat/tests/tags.yml
rename to modules/gallvp/cat/cat/tests/tags.yml
diff --git a/modules/pfr/custom/relabelfasta/environment.yml b/modules/gallvp/custom/relabelfasta/environment.yml
similarity index 100%
rename from modules/pfr/custom/relabelfasta/environment.yml
rename to modules/gallvp/custom/relabelfasta/environment.yml
diff --git a/modules/pfr/custom/relabelfasta/main.nf b/modules/gallvp/custom/relabelfasta/main.nf
similarity index 100%
rename from modules/pfr/custom/relabelfasta/main.nf
rename to modules/gallvp/custom/relabelfasta/main.nf
diff --git a/modules/pfr/custom/relabelfasta/meta.yml b/modules/gallvp/custom/relabelfasta/meta.yml
similarity index 100%
rename from modules/pfr/custom/relabelfasta/meta.yml
rename to modules/gallvp/custom/relabelfasta/meta.yml
diff --git a/modules/pfr/custom/relabelfasta/templates/relabelfasta.py b/modules/gallvp/custom/relabelfasta/templates/relabelfasta.py
similarity index 79%
rename from modules/pfr/custom/relabelfasta/templates/relabelfasta.py
rename to modules/gallvp/custom/relabelfasta/templates/relabelfasta.py
index 039941c6..d4af0547 100755
--- a/modules/pfr/custom/relabelfasta/templates/relabelfasta.py
+++ b/modules/gallvp/custom/relabelfasta/templates/relabelfasta.py
@@ -24,14 +24,10 @@ def create_name_mapping_from_tsv(file_path):
             orig_id, new_id = columns[0], columns[1]
 
             if orig_id in dictionary.keys():
-                raise ValueError(
-                    f"{orig_id} is repeated in {file_path}. Each sequence ID should be unique"
-                )
+                raise ValueError(f"{orig_id} is repeated in {file_path}. Each sequence ID should be unique")
 
             if new_id in dictionary.values():
-                raise ValueError(
-                    f"{new_id} is repeated in {file_path}. Each sequence label should be unique"
-                )
+                raise ValueError(f"{new_id} is repeated in {file_path}. Each sequence label should be unique")
 
             dictionary[orig_id] = new_id
 
@@ -60,16 +56,10 @@ def write_fasta_with_new_ids(fasta_file_path, orig_to_new_id_map, file_prefix):
         )
 
     selected_ids = [record.id for record in replaced_records]
-    missing_ids = [
-        orig_id
-        for (orig_id, new_id) in orig_to_new_id_map.items()
-        if new_id not in selected_ids
-    ]
+    missing_ids = [orig_id for (orig_id, new_id) in orig_to_new_id_map.items() if new_id not in selected_ids]
 
     if len(missing_ids) > 0:
-        raise ValueError(
-            f"Some sequences {missing_ids} are missing from the fasta {fasta_file_path}"
-        )
+        raise ValueError(f"Some sequences {missing_ids} are missing from the fasta {fasta_file_path}")
 
     SeqIO.write(replaced_records, f"{file_prefix}.fasta", "fasta")
 
diff --git a/modules/pfr/custom/relabelfasta/tests/main.nf.test b/modules/gallvp/custom/relabelfasta/tests/main.nf.test
similarity index 82%
rename from modules/pfr/custom/relabelfasta/tests/main.nf.test
rename to modules/gallvp/custom/relabelfasta/tests/main.nf.test
index 64ccb08f..7097845f 100644
--- a/modules/pfr/custom/relabelfasta/tests/main.nf.test
+++ b/modules/gallvp/custom/relabelfasta/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "CUSTOM_RELABELFASTA"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "custom"
     tag "custom/relabelfasta"
 
@@ -15,7 +15,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\tChr1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -38,7 +38,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\\tChr1\\nMT19276\\tChr1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -61,7 +61,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\\tChr1\\nMT192765.1\\tChr1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -84,7 +84,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\\tChr1\\nMT192765.1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -107,7 +107,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\\tChr1\\nMT192765.2\\tChr2').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -133,7 +133,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = Channel.of('MT192765.1\tChr1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
diff --git a/modules/pfr/custom/relabelfasta/tests/main.nf.test.snap b/modules/gallvp/custom/relabelfasta/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/custom/relabelfasta/tests/main.nf.test.snap
rename to modules/gallvp/custom/relabelfasta/tests/main.nf.test.snap
diff --git a/modules/pfr/custom/restoregffids/environment.yml b/modules/gallvp/custom/restoregffids/environment.yml
similarity index 100%
rename from modules/pfr/custom/restoregffids/environment.yml
rename to modules/gallvp/custom/restoregffids/environment.yml
diff --git a/modules/pfr/custom/restoregffids/main.nf b/modules/gallvp/custom/restoregffids/main.nf
similarity index 100%
rename from modules/pfr/custom/restoregffids/main.nf
rename to modules/gallvp/custom/restoregffids/main.nf
diff --git a/modules/pfr/custom/restoregffids/meta.yml b/modules/gallvp/custom/restoregffids/meta.yml
similarity index 100%
rename from modules/pfr/custom/restoregffids/meta.yml
rename to modules/gallvp/custom/restoregffids/meta.yml
diff --git a/modules/pfr/custom/restoregffids/templates/restore_gff_ids.py b/modules/gallvp/custom/restoregffids/templates/restore_gff_ids.py
similarity index 100%
rename from modules/pfr/custom/restoregffids/templates/restore_gff_ids.py
rename to modules/gallvp/custom/restoregffids/templates/restore_gff_ids.py
diff --git a/modules/pfr/custom/restoregffids/tests/main.nf.test b/modules/gallvp/custom/restoregffids/tests/main.nf.test
similarity index 85%
rename from modules/pfr/custom/restoregffids/tests/main.nf.test
rename to modules/gallvp/custom/restoregffids/tests/main.nf.test
index 20aa85c9..2c248c99 100644
--- a/modules/pfr/custom/restoregffids/tests/main.nf.test
+++ b/modules/gallvp/custom/restoregffids/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "CUSTOM_RESTOREGFFIDS"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "custom"
     tag "custom/restoregffids"
 
@@ -15,7 +15,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:false ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ]
                 input[1] = Channel.of('Chr1\tMT192765.1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
@@ -43,7 +43,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:false ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ]
                 input[1] = Channel.of('Chr1\tMT192765.1').collectFile(name: 'id_map.tsv', newLine: true)
                 """
diff --git a/modules/pfr/custom/restoregffids/tests/main.nf.test.snap b/modules/gallvp/custom/restoregffids/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/custom/restoregffids/tests/main.nf.test.snap
rename to modules/gallvp/custom/restoregffids/tests/main.nf.test.snap
diff --git a/modules/pfr/custom/shortenfastaids/environment.yml b/modules/gallvp/custom/shortenfastaids/environment.yml
similarity index 100%
rename from modules/pfr/custom/shortenfastaids/environment.yml
rename to modules/gallvp/custom/shortenfastaids/environment.yml
diff --git a/modules/pfr/custom/shortenfastaids/main.nf b/modules/gallvp/custom/shortenfastaids/main.nf
similarity index 100%
rename from modules/pfr/custom/shortenfastaids/main.nf
rename to modules/gallvp/custom/shortenfastaids/main.nf
diff --git a/modules/pfr/custom/shortenfastaids/meta.yml b/modules/gallvp/custom/shortenfastaids/meta.yml
similarity index 100%
rename from modules/pfr/custom/shortenfastaids/meta.yml
rename to modules/gallvp/custom/shortenfastaids/meta.yml
diff --git a/modules/pfr/custom/shortenfastaids/templates/shorten_fasta_ids.py b/modules/gallvp/custom/shortenfastaids/templates/shorten_fasta_ids.py
similarity index 88%
rename from modules/pfr/custom/shortenfastaids/templates/shorten_fasta_ids.py
rename to modules/gallvp/custom/shortenfastaids/templates/shorten_fasta_ids.py
index 0ce43903..9d9c6e16 100755
--- a/modules/pfr/custom/shortenfastaids/templates/shorten_fasta_ids.py
+++ b/modules/gallvp/custom/shortenfastaids/templates/shorten_fasta_ids.py
@@ -61,12 +61,7 @@ def do_id_need_to_change(id_and_description, silent=False):
 
 
 def do_ids_need_to_change(ids_and_descriptions, silent=False):
-    return any(
-        [
-            do_id_need_to_change(id_and_description, silent)
-            for id_and_description in ids_and_descriptions
-        ]
-    )
+    return any([do_id_need_to_change(id_and_description, silent) for id_and_description in ids_and_descriptions])
 
 
 def extract_common_patterns(ids):
@@ -76,9 +71,7 @@ def extract_common_patterns(ids):
         for pattern in set(patterns):
             pattern_counts[pattern] = pattern_counts.get(pattern, 0) + 1
 
-    common_patterns = [
-        pattern for pattern, count in pattern_counts.items() if count >= 2
-    ]
+    common_patterns = [pattern for pattern, count in pattern_counts.items() if count >= 2]
 
     if len(common_patterns) < 1:
         return {}
@@ -126,11 +119,7 @@ def shorten_id_by_pattern_replacement(patterns_dict, id):
             patterns_dict[pattern],
             shortened_id,
         )
-    return (
-        shortened_id
-        if shortened_id[len(shortened_id) - 1] != "_"
-        else shortened_id[0 : (len(shortened_id) - 1)]
-    )
+    return shortened_id if shortened_id[len(shortened_id) - 1] != "_" else shortened_id[0 : (len(shortened_id) - 1)]
 
 
 def match_substrings(substrings, target_string):
@@ -169,15 +158,11 @@ def fail_if_new_ids_not_valid(ids):
             f.write("IDs have acceptable length and character. No change required.")
         exit(0)
 
-    new_ids = shorten_ids(
-        input_ids_and_descriptions, extract_common_patterns(input_ids)
-    )
+    new_ids = shorten_ids(input_ids_and_descriptions, extract_common_patterns(input_ids))
     fail_if_new_ids_not_valid(new_ids)
 
     with open(f"{output_files_prefix}.short.ids.tsv", "w") as f:
         for input_id, new_id in zip(input_ids, new_ids):
             f.write(f"{input_id}\\t{new_id}\\n")
 
-    write_fasta_with_new_ids(
-        fasta_file_path, zip(input_ids, new_ids), output_files_prefix
-    )
+    write_fasta_with_new_ids(fasta_file_path, zip(input_ids, new_ids), output_files_prefix)
diff --git a/modules/pfr/custom/shortenfastaids/tests/main.nf.test b/modules/gallvp/custom/shortenfastaids/tests/main.nf.test
similarity index 81%
rename from modules/pfr/custom/shortenfastaids/tests/main.nf.test
rename to modules/gallvp/custom/shortenfastaids/tests/main.nf.test
index c87e8ebf..8eb2099c 100644
--- a/modules/pfr/custom/shortenfastaids/tests/main.nf.test
+++ b/modules/gallvp/custom/shortenfastaids/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "CUSTOM_SHORTENFASTAIDS"
 
     tag "modules"
-    tag "modules_pfr"
+    tag "modules_gallvp"
     tag "custom"
     tag "custom/shortenfastaids"
 
@@ -16,7 +16,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 """
             }
@@ -38,7 +38,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 """
             }
@@ -60,7 +60,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true)
                 ]
                 """
             }
@@ -105,7 +105,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 """
             }
diff --git a/modules/pfr/custom/shortenfastaids/tests/main.nf.test.snap b/modules/gallvp/custom/shortenfastaids/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/custom/shortenfastaids/tests/main.nf.test.snap
rename to modules/gallvp/custom/shortenfastaids/tests/main.nf.test.snap
diff --git a/modules/pfr/gffread/environment.yml b/modules/gallvp/gffread/environment.yml
similarity index 100%
rename from modules/pfr/gffread/environment.yml
rename to modules/gallvp/gffread/environment.yml
diff --git a/modules/pfr/gffread/main.nf b/modules/gallvp/gffread/main.nf
similarity index 100%
rename from modules/pfr/gffread/main.nf
rename to modules/gallvp/gffread/main.nf
diff --git a/modules/pfr/gffread/meta.yml b/modules/gallvp/gffread/meta.yml
similarity index 100%
rename from modules/pfr/gffread/meta.yml
rename to modules/gallvp/gffread/meta.yml
diff --git a/modules/pfr/gffread/tests/main.nf.test b/modules/gallvp/gffread/tests/main.nf.test
similarity index 99%
rename from modules/pfr/gffread/tests/main.nf.test
rename to modules/gallvp/gffread/tests/main.nf.test
index 4cd13dcd..17b2ee64 100644
--- a/modules/pfr/gffread/tests/main.nf.test
+++ b/modules/gallvp/gffread/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "GFFREAD"
 
     tag "gffread"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "modules"
 
     test("sarscov2-gff3-gtf") {
diff --git a/modules/pfr/gffread/tests/main.nf.test.snap b/modules/gallvp/gffread/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/gffread/tests/main.nf.test.snap
rename to modules/gallvp/gffread/tests/main.nf.test.snap
diff --git a/modules/pfr/gffread/tests/nextflow-fasta.config b/modules/gallvp/gffread/tests/nextflow-fasta.config
similarity index 100%
rename from modules/pfr/gffread/tests/nextflow-fasta.config
rename to modules/gallvp/gffread/tests/nextflow-fasta.config
diff --git a/modules/pfr/gffread/tests/nextflow-gff3.config b/modules/gallvp/gffread/tests/nextflow-gff3.config
similarity index 100%
rename from modules/pfr/gffread/tests/nextflow-gff3.config
rename to modules/gallvp/gffread/tests/nextflow-gff3.config
diff --git a/modules/pfr/gffread/tests/nextflow.config b/modules/gallvp/gffread/tests/nextflow.config
similarity index 100%
rename from modules/pfr/gffread/tests/nextflow.config
rename to modules/gallvp/gffread/tests/nextflow.config
diff --git a/modules/pfr/gffread/tests/tags.yml b/modules/gallvp/gffread/tests/tags.yml
similarity index 100%
rename from modules/pfr/gffread/tests/tags.yml
rename to modules/gallvp/gffread/tests/tags.yml
diff --git a/modules/pfr/gt/gff3/environment.yml b/modules/gallvp/gt/gff3/environment.yml
similarity index 100%
rename from modules/pfr/gt/gff3/environment.yml
rename to modules/gallvp/gt/gff3/environment.yml
diff --git a/modules/pfr/gt/gff3/main.nf b/modules/gallvp/gt/gff3/main.nf
similarity index 100%
rename from modules/pfr/gt/gff3/main.nf
rename to modules/gallvp/gt/gff3/main.nf
diff --git a/modules/pfr/gt/gff3/meta.yml b/modules/gallvp/gt/gff3/meta.yml
similarity index 100%
rename from modules/pfr/gt/gff3/meta.yml
rename to modules/gallvp/gt/gff3/meta.yml
diff --git a/modules/pfr/gt/gff3/tests/main.nf.test b/modules/gallvp/gt/gff3/tests/main.nf.test
similarity index 91%
rename from modules/pfr/gt/gff3/tests/main.nf.test
rename to modules/gallvp/gt/gff3/tests/main.nf.test
index cb44bc8f..f8e8c9fa 100644
--- a/modules/pfr/gt/gff3/tests/main.nf.test
+++ b/modules/gallvp/gt/gff3/tests/main.nf.test
@@ -6,7 +6,7 @@ nextflow_process {
     config "./nextflow.config"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "gt"
     tag "gt/gff3"
 
@@ -16,7 +16,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ]
                 """
             }
diff --git a/modules/pfr/gt/gff3/tests/main.nf.test.snap b/modules/gallvp/gt/gff3/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/gt/gff3/tests/main.nf.test.snap
rename to modules/gallvp/gt/gff3/tests/main.nf.test.snap
diff --git a/modules/pfr/gt/gff3/tests/nextflow.config b/modules/gallvp/gt/gff3/tests/nextflow.config
similarity index 100%
rename from modules/pfr/gt/gff3/tests/nextflow.config
rename to modules/gallvp/gt/gff3/tests/nextflow.config
diff --git a/modules/pfr/gt/gff3/tests/tags.yml b/modules/gallvp/gt/gff3/tests/tags.yml
similarity index 100%
rename from modules/pfr/gt/gff3/tests/tags.yml
rename to modules/gallvp/gt/gff3/tests/tags.yml
diff --git a/modules/pfr/gt/gff3validator/environment.yml b/modules/gallvp/gt/gff3validator/environment.yml
similarity index 100%
rename from modules/pfr/gt/gff3validator/environment.yml
rename to modules/gallvp/gt/gff3validator/environment.yml
diff --git a/modules/pfr/gt/gff3validator/main.nf b/modules/gallvp/gt/gff3validator/main.nf
similarity index 100%
rename from modules/pfr/gt/gff3validator/main.nf
rename to modules/gallvp/gt/gff3validator/main.nf
diff --git a/modules/pfr/gt/gff3validator/meta.yml b/modules/gallvp/gt/gff3validator/meta.yml
similarity index 100%
rename from modules/pfr/gt/gff3validator/meta.yml
rename to modules/gallvp/gt/gff3validator/meta.yml
diff --git a/modules/pfr/gt/gff3validator/tests/main.nf.test b/modules/gallvp/gt/gff3validator/tests/main.nf.test
similarity index 81%
rename from modules/pfr/gt/gff3validator/tests/main.nf.test
rename to modules/gallvp/gt/gff3validator/tests/main.nf.test
index 766e3e74..029517c2 100644
--- a/modules/pfr/gt/gff3validator/tests/main.nf.test
+++ b/modules/gallvp/gt/gff3validator/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "GT_GFF3VALIDATOR"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "gt"
     tag "gt/gff3validator"
     tag "gt/gff3"
@@ -16,13 +16,13 @@ nextflow_process {
 
         setup {
             run("GT_GFF3") {
-                script "../../../../nf-core/gt/gff3"
+                script "../../../gt/gff3"
 
                 process {
                     """
                     input[0] = [
                         [ id:'test' ],
-                        file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                     ]
                     """
                 }
@@ -57,7 +57,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ]
                 """
             }
@@ -79,7 +79,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['homo_sapiens']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gff3', checkIfExists: true)
                 ]
                 """
             }
diff --git a/modules/pfr/gt/gff3validator/tests/main.nf.test.snap b/modules/gallvp/gt/gff3validator/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/gt/gff3validator/tests/main.nf.test.snap
rename to modules/gallvp/gt/gff3validator/tests/main.nf.test.snap
diff --git a/modules/pfr/gt/gff3validator/tests/nextflow.config b/modules/gallvp/gt/gff3validator/tests/nextflow.config
similarity index 100%
rename from modules/pfr/gt/gff3validator/tests/nextflow.config
rename to modules/gallvp/gt/gff3validator/tests/nextflow.config
diff --git a/modules/pfr/gt/gff3validator/tests/tags.yml b/modules/gallvp/gt/gff3validator/tests/tags.yml
similarity index 100%
rename from modules/pfr/gt/gff3validator/tests/tags.yml
rename to modules/gallvp/gt/gff3validator/tests/tags.yml
diff --git a/modules/pfr/gt/stat/environment.yml b/modules/gallvp/gt/stat/environment.yml
similarity index 100%
rename from modules/pfr/gt/stat/environment.yml
rename to modules/gallvp/gt/stat/environment.yml
diff --git a/modules/pfr/gt/stat/main.nf b/modules/gallvp/gt/stat/main.nf
similarity index 100%
rename from modules/pfr/gt/stat/main.nf
rename to modules/gallvp/gt/stat/main.nf
diff --git a/modules/pfr/gt/stat/meta.yml b/modules/gallvp/gt/stat/meta.yml
similarity index 100%
rename from modules/pfr/gt/stat/meta.yml
rename to modules/gallvp/gt/stat/meta.yml
diff --git a/modules/pfr/gt/stat/tests/main.nf.test b/modules/gallvp/gt/stat/tests/main.nf.test
similarity index 81%
rename from modules/pfr/gt/stat/tests/main.nf.test
rename to modules/gallvp/gt/stat/tests/main.nf.test
index d1fe2f0d..cdc5d5fd 100644
--- a/modules/pfr/gt/stat/tests/main.nf.test
+++ b/modules/gallvp/gt/stat/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "GT_STAT"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "gt"
     tag "gt/stat"
 
@@ -16,7 +16,7 @@ nextflow_process {
                 """
                 input[0] = Channel.of(
                     "##gff-version 3" +
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true).text.toLowerCase()
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true).text.toLowerCase()
                 )
                 .collectFile(name: 'sample.gff3', newLine: true)
                 .map { file -> [ [ id:'test' ], file ] }
@@ -43,7 +43,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id: 'test' ],
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ]
                 """
             }
diff --git a/modules/pfr/gt/stat/tests/main.nf.test.snap b/modules/gallvp/gt/stat/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/gt/stat/tests/main.nf.test.snap
rename to modules/gallvp/gt/stat/tests/main.nf.test.snap
diff --git a/modules/pfr/gt/stat/tests/tags.yml b/modules/gallvp/gt/stat/tests/tags.yml
similarity index 100%
rename from modules/pfr/gt/stat/tests/tags.yml
rename to modules/gallvp/gt/stat/tests/tags.yml
diff --git a/modules/pfr/ltrfinder/environment.yml b/modules/gallvp/ltrfinder/environment.yml
similarity index 100%
rename from modules/pfr/ltrfinder/environment.yml
rename to modules/gallvp/ltrfinder/environment.yml
diff --git a/modules/pfr/ltrfinder/main.nf b/modules/gallvp/ltrfinder/main.nf
similarity index 100%
rename from modules/pfr/ltrfinder/main.nf
rename to modules/gallvp/ltrfinder/main.nf
diff --git a/modules/pfr/ltrfinder/meta.yml b/modules/gallvp/ltrfinder/meta.yml
similarity index 100%
rename from modules/pfr/ltrfinder/meta.yml
rename to modules/gallvp/ltrfinder/meta.yml
diff --git a/modules/pfr/ltrfinder/tests/main.nf.test b/modules/gallvp/ltrfinder/tests/main.nf.test
similarity index 54%
rename from modules/pfr/ltrfinder/tests/main.nf.test
rename to modules/gallvp/ltrfinder/tests/main.nf.test
index 361e7324..c08af00a 100644
--- a/modules/pfr/ltrfinder/tests/main.nf.test
+++ b/modules/gallvp/ltrfinder/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "LTRFINDER"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "ltrfinder"
     tag "gunzip/main"
 
@@ -19,7 +19,7 @@ nextflow_process {
                     """
                     input[0] = [
                         [ id:'test' ], // meta map
-                        file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                     ]
                     """
                 }
@@ -37,8 +37,29 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(process.out).match() },
-                { assert snapshot(path(process.out.versions[0]).text).match("versions") }
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2-genome_fasta-no_ltr") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
             )
         }
 
@@ -53,7 +74,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                 ]
                 """
             }
@@ -62,11 +83,10 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(process.out).match() },
-                { assert snapshot(path(process.out.versions[0]).text).match("stub_versions") }
+                { assert snapshot(process.out).match() }
             )
         }
 
     }
 
-}
\ No newline at end of file
+}
diff --git a/modules/pfr/ltrfinder/tests/main.nf.test.snap b/modules/gallvp/ltrfinder/tests/main.nf.test.snap
similarity index 68%
rename from modules/pfr/ltrfinder/tests/main.nf.test.snap
rename to modules/gallvp/ltrfinder/tests/main.nf.test.snap
index 54a2cee1..0f1790fc 100644
--- a/modules/pfr/ltrfinder/tests/main.nf.test.snap
+++ b/modules/gallvp/ltrfinder/tests/main.nf.test.snap
@@ -48,15 +48,54 @@
         },
         "timestamp": "2024-02-16T09:14:38.509965"
     },
-    "versions": {
+    "sarscov2-genome_fasta-no_ltr": {
         "content": [
-            "\"LTRFINDER\":\n    LTR_FINDER_parallel: v1.1\n    ltr_finder: v1.07\n"
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.scn:md5,2ce449dff751e59dbc292b6888491954"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.gff3:md5,bddeb04277af08b5850e64708e8af02a"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,7b24225b810fa88cfb2a887de11be333"
+                ],
+                "gff": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.gff3:md5,bddeb04277af08b5850e64708e8af02a"
+                    ]
+                ],
+                "scn": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.scn:md5,2ce449dff751e59dbc292b6888491954"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,7b24225b810fa88cfb2a887de11be333"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-16T09:16:55.301422"
+        "timestamp": "2024-07-16T13:03:03.505263"
     },
     "stub": {
         "content": [
@@ -106,15 +145,5 @@
             "nextflow": "23.10.1"
         },
         "timestamp": "2024-02-16T09:14:43.054758"
-    },
-    "stub_versions": {
-        "content": [
-            "\"LTRFINDER\":\n    LTR_FINDER_parallel: v1.1\n    ltr_finder: v1.07\n"
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-16T09:16:59.800724"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/ltrharvest/environment.yml b/modules/gallvp/ltrharvest/environment.yml
similarity index 100%
rename from modules/pfr/ltrharvest/environment.yml
rename to modules/gallvp/ltrharvest/environment.yml
diff --git a/modules/pfr/ltrharvest/main.nf b/modules/gallvp/ltrharvest/main.nf
similarity index 100%
rename from modules/pfr/ltrharvest/main.nf
rename to modules/gallvp/ltrharvest/main.nf
diff --git a/modules/pfr/ltrharvest/meta.yml b/modules/gallvp/ltrharvest/meta.yml
similarity index 100%
rename from modules/pfr/ltrharvest/meta.yml
rename to modules/gallvp/ltrharvest/meta.yml
diff --git a/modules/gallvp/ltrharvest/tests/main.nf.test b/modules/gallvp/ltrharvest/tests/main.nf.test
new file mode 100644
index 00000000..e53f347e
--- /dev/null
+++ b/modules/gallvp/ltrharvest/tests/main.nf.test
@@ -0,0 +1,89 @@
+nextflow_process {
+
+    name "Test Process LTRHARVEST"
+    script "../main.nf"
+    process "LTRHARVEST"
+
+    tag "modules"
+    tag "modules_gallvp"
+    tag "ltrharvest"
+
+    test("homo_sapiens - genome_21_fasta") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.gff3,
+                    process.out.versions
+                    ).match()
+                },
+                { assert path(process.out.scn[0][1]).text.contains("46510803 46520182 9380 46510803 46510940 138 46520042 46520182 141 86.52 0 chr21") },
+            )
+        }
+
+    }
+
+    test("sarscov2 - genome_fasta - no_ltr") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.gff3,
+                    process.out.versions
+                    ).match()
+                },
+                { assert path(process.out.scn[0][1]).text.contains("predictions are reported in the following way") },
+            )
+        }
+
+    }
+
+    test("homo_sapiens - genome_fasta - stub") {
+
+        options '-stub'
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/pfr/ltrharvest/tests/main.nf.test.snap b/modules/gallvp/ltrharvest/tests/main.nf.test.snap
similarity index 69%
rename from modules/pfr/ltrharvest/tests/main.nf.test.snap
rename to modules/gallvp/ltrharvest/tests/main.nf.test.snap
index ad47c4ae..f3a8da8c 100644
--- a/modules/pfr/ltrharvest/tests/main.nf.test.snap
+++ b/modules/gallvp/ltrharvest/tests/main.nf.test.snap
@@ -1,5 +1,25 @@
 {
-    "homo_sapiens-genome_fasta-stub": {
+    "sarscov2 - genome_fasta - no_ltr": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.gff3:md5,bddeb04277af08b5850e64708e8af02a"
+                ]
+            ],
+            [
+                "versions.yml:md5,51e82185b713482d1d48b6f15abe7fcc"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-17T10:40:36.380052"
+    },
+    "homo_sapiens - genome_fasta - stub": {
         "content": [
             {
                 "0": [
@@ -44,21 +64,11 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-22T14:44:30.682167"
+        "timestamp": "2024-07-17T10:40:40.967557"
     },
-    "script_versions": {
-        "content": [
-            "\"LTRHARVEST\":\n    LTR_HARVEST_parallel: v1.1\n    genometools: 1.6.5\n"
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-22T14:44:26.672478"
-    },
-    "gff3": {
+    "homo_sapiens - genome_21_fasta": {
         "content": [
             [
                 [
@@ -67,22 +77,15 @@
                     },
                     "test.gff3:md5,da13c4ba22e44ef944ddec38aa72c468"
                 ]
+            ],
+            [
+                "versions.yml:md5,51e82185b713482d1d48b6f15abe7fcc"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-22T19:29:33.962761"
-    },
-    "stub_versions": {
-        "content": [
-            "\"LTRHARVEST\":\n    LTR_HARVEST_parallel: v1.1\n    genometools: 1.6.5\n"
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-22T14:44:30.729166"
+        "timestamp": "2024-07-17T10:40:30.946"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/ltrretriever/lai/environment.yml b/modules/gallvp/ltrretriever/lai/environment.yml
similarity index 100%
rename from modules/pfr/ltrretriever/lai/environment.yml
rename to modules/gallvp/ltrretriever/lai/environment.yml
diff --git a/modules/pfr/ltrretriever/lai/main.nf b/modules/gallvp/ltrretriever/lai/main.nf
similarity index 100%
rename from modules/pfr/ltrretriever/lai/main.nf
rename to modules/gallvp/ltrretriever/lai/main.nf
diff --git a/modules/pfr/ltrretriever/lai/meta.yml b/modules/gallvp/ltrretriever/lai/meta.yml
similarity index 100%
rename from modules/pfr/ltrretriever/lai/meta.yml
rename to modules/gallvp/ltrretriever/lai/meta.yml
diff --git a/modules/pfr/ltrretriever/lai/tests/main.nf.test b/modules/gallvp/ltrretriever/lai/tests/main.nf.test
similarity index 89%
rename from modules/pfr/ltrretriever/lai/tests/main.nf.test
rename to modules/gallvp/ltrretriever/lai/tests/main.nf.test
index a617811b..e4289189 100644
--- a/modules/pfr/ltrretriever/lai/tests/main.nf.test
+++ b/modules/gallvp/ltrretriever/lai/tests/main.nf.test
@@ -6,7 +6,7 @@ nextflow_process {
     config "./nextflow.config"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "gunzip"
     tag "ltrretriever"
     tag "ltrretriever/ltrretriever"
@@ -26,7 +26,7 @@ nextflow_process {
                     """
                     input[0] = [
                         [ id:'test' ],
-                        file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                     ]
                     """
                 }
@@ -114,7 +114,7 @@ nextflow_process {
 
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                 ]
                 input[1] = pass_list.toPath()
                 input[2] = out_file.toPath()
@@ -145,7 +145,7 @@ nextflow_process {
 
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                 ]
                 input[1] = pass_list.toPath()
                 input[2] = out_file.toPath()
@@ -163,4 +163,4 @@ nextflow_process {
 
     }
 
-}
\ No newline at end of file
+}
diff --git a/modules/pfr/ltrretriever/lai/tests/main.nf.test.snap b/modules/gallvp/ltrretriever/lai/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/ltrretriever/lai/tests/main.nf.test.snap
rename to modules/gallvp/ltrretriever/lai/tests/main.nf.test.snap
diff --git a/modules/pfr/ltrretriever/lai/tests/nextflow.config b/modules/gallvp/ltrretriever/lai/tests/nextflow.config
similarity index 100%
rename from modules/pfr/ltrretriever/lai/tests/nextflow.config
rename to modules/gallvp/ltrretriever/lai/tests/nextflow.config
diff --git a/modules/pfr/ltrretriever/lai/tests/tags.yml b/modules/gallvp/ltrretriever/lai/tests/tags.yml
similarity index 100%
rename from modules/pfr/ltrretriever/lai/tests/tags.yml
rename to modules/gallvp/ltrretriever/lai/tests/tags.yml
diff --git a/modules/pfr/ltrretriever/ltrretriever/environment.yml b/modules/gallvp/ltrretriever/ltrretriever/environment.yml
similarity index 100%
rename from modules/pfr/ltrretriever/ltrretriever/environment.yml
rename to modules/gallvp/ltrretriever/ltrretriever/environment.yml
diff --git a/modules/pfr/ltrretriever/ltrretriever/main.nf b/modules/gallvp/ltrretriever/ltrretriever/main.nf
similarity index 62%
rename from modules/pfr/ltrretriever/ltrretriever/main.nf
rename to modules/gallvp/ltrretriever/ltrretriever/main.nf
index f4577920..8e1e2beb 100644
--- a/modules/pfr/ltrretriever/ltrretriever/main.nf
+++ b/modules/gallvp/ltrretriever/ltrretriever/main.nf
@@ -16,9 +16,9 @@ process LTRRETRIEVER_LTRRETRIEVER {
 
     output:
     tuple val(meta), path("*.log")              , emit: log
-    tuple val(meta), path("${prefix}.pass.list"), emit: pass_list
-    tuple val(meta), path("*.pass.list.gff3")   , emit: pass_list_gff
-    tuple val(meta), path("*.LTRlib.fa")        , emit: ltrlib
+    tuple val(meta), path("${prefix}.pass.list"), emit: pass_list       , optional: true
+    tuple val(meta), path("*.pass.list.gff3")   , emit: pass_list_gff   , optional: true
+    tuple val(meta), path("*.LTRlib.fa")        , emit: ltrlib          , optional: true
     tuple val(meta), path("${prefix}.out")      , emit: annotation_out  , optional: true
     tuple val(meta), path("*.out.gff3")         , emit: annotation_gff  , optional: true
     path "versions.yml"                         , emit: versions
@@ -33,22 +33,39 @@ process LTRRETRIEVER_LTRRETRIEVER {
     def infinder        = finder            ? "-infinder $finder"   : ''
     def inmgescan       = mgescan           ? "-inmgescan $mgescan" : ''
     def non_tgca_file   = non_tgca          ? "-nonTGCA $non_tgca"  : ''
+    def writable_genome = "${genome.baseName}.writable.${genome.extension}"
+    // writable_genome:
+    // This is needed to avoid LTR_retriever:2.9.9 failure when the input `genome` is
+    // readonly. LTR_retriever triggers a 'die' if the genome is readonly.
+    // See: https://github.com/oushujun/LTR_retriever/blob/4039eb7778fd9cbc60021e99a8693285e0fa2daf/LTR_retriever#L312
+    //
+    // This copy with permissions logic can be removed once https://github.com/oushujun/LTR_retriever/issues/176
+    // has been resolved.
     """
+    cp \\
+        $genome \\
+        $writable_genome
+
+    chmod \\
+        a+w \\
+        $writable_genome
+
     LTR_retriever \\
-        -genome $genome \\
+        -genome $writable_genome \\
         $inharvest \\
         $infinder \\
         $inmgescan \\
         $non_tgca_file \\
         -threads $task.cpus \\
         $args \\
-        &> >(tee "${prefix}.log" 2>&1)
+        &> >(tee "${prefix}.log" 2>&1) \\
+        || echo "Errors from LTR_retriever printed to ${prefix}.log"
 
-    mv "${genome}.pass.list"        "${prefix}.pass.list"
-    mv "${genome}.pass.list.gff3"   "${prefix}.pass.list.gff3"
-    mv "${genome}.LTRlib.fa"        "${prefix}.LTRlib.fa"
-    mv "${genome}.out"              "${prefix}.out"             || echo ".out was not produced"
-    mv "${genome}.out.gff3"         "${prefix}.out.gff3"        || echo ".out.gff3 was not produced"
+    mv "${writable_genome}.pass.list"       "${prefix}.pass.list"       || echo ".pass.list was not produced"
+    mv "${writable_genome}.pass.list.gff3"  "${prefix}.pass.list.gff3"  || echo ".pass.list.gff3 was not produced"
+    mv "${writable_genome}.LTRlib.fa"       "${prefix}.LTRlib.fa"       || echo ".LTRlib.fa was not produced"
+    mv "${writable_genome}.out"             "${prefix}.out"             || echo ".out was not produced"
+    mv "${writable_genome}.out.gff3"        "${prefix}.out.gff3"        || echo ".out.gff3 was not produced"
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/pfr/ltrretriever/ltrretriever/meta.yml b/modules/gallvp/ltrretriever/ltrretriever/meta.yml
similarity index 100%
rename from modules/pfr/ltrretriever/ltrretriever/meta.yml
rename to modules/gallvp/ltrretriever/ltrretriever/meta.yml
diff --git a/modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test b/modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test
similarity index 53%
rename from modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test
rename to modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test
index e8e13a60..91b1a104 100644
--- a/modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test
+++ b/modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test
@@ -6,49 +6,103 @@ nextflow_process {
     config "./nextflow.config"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "ltrretriever"
     tag "ltrretriever/ltrretriever"
     tag "gunzip/main"
-    tag "gt/ltrharvest"
-    tag "gt/suffixerator"
+    tag "ltrharvest"
     tag "ltrfinder"
     tag "cat/cat"
 
-    test("actinidia_chinensis-genome_21_fasta_gz-success") {
+    test("sarscov2-genome-no_ltr") {
 
         setup {
 
-            run('GUNZIP') {
-                script "../../../gunzip/main"
+            run("LTRHARVEST") {
+                script "../../../ltrharvest"
 
                 process {
                     """
                     input[0] = [
-                        [ id:'test' ], // meta map
-                        file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                        [ id: 'test' ],
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                     ]
                     """
                 }
             }
 
-            run("GT_SUFFIXERATOR") {
-                script "../../../gt/suffixerator"
+            run("LTRFINDER") {
+                script "../../../ltrfinder"
 
                 process {
                     """
-                    input[0] = GUNZIP.out.gunzip
-                    input[1] = 'dna'
+                    input[0] = [
+                        [ id: 'test' ],
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+
+            run("CAT_CAT") {
+                script "../../../cat/cat"
+
+                process {
+                    """
+                    input[0] = LTRHARVEST.out.scn.mix(LTRFINDER.out.scn).groupTuple()
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = input[0] = [
+                    [ id: 'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[1] = CAT_CAT.out.file_out.map { meta, tabout -> tabout }
+                input[2] = []
+                input[3] = []
+                input[4] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.log[0][1]).text.contains("ERROR: No candidate is found in the file(s) you specified.") },
+                { assert snapshot(process.out.versions).match("versions_no_ltr") }
+            )
+        }
+
+    }
+
+    test("actinidia_chinensis-genome_21_fasta_gz-success") {
+
+        setup {
+
+            run('GUNZIP') {
+                script "../../../gunzip/main"
+
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test' ], // meta map
+                        file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
+                    ]
                     """
                 }
             }
 
-            run("GT_LTRHARVEST") {
-                script "../../../gt/ltrharvest"
+            run("LTRHARVEST") {
+                script "../../../ltrharvest"
 
                 process {
                     """
-                    input[0] = GT_SUFFIXERATOR.out.index
+                    input[0] = GUNZIP.out.gunzip
                     """
                 }
             }
@@ -68,7 +122,7 @@ nextflow_process {
 
                 process {
                     """
-                    input[0] = GT_LTRHARVEST.out.tabout.mix(LTRFINDER.out.scn).groupTuple()
+                    input[0] = LTRHARVEST.out.scn.mix(LTRFINDER.out.scn).groupTuple()
                     """
                 }
             }
@@ -90,7 +144,7 @@ nextflow_process {
             assertAll(
                 { assert process.success },
                 { assert path(process.out.log[0][1]).text.contains("####### Result files #########") },
-                { assert snapshot(process.out.pass_list).match("pass_list") },
+                { assert path(process.out.pass_list[0][1]).text.contains("Copia\tLTR") },
                 { assert path(process.out.pass_list_gff[0][1]).text.contains("chr1\tLTR_retriever\ttarget_site_duplication") },
                 { assert path(process.out.ltrlib[0][1]).text.contains("LTR#LTR/Copia") },
                 { assert snapshot(process.out.annotation_out).match("annotation_out") },
@@ -110,7 +164,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test' ], // meta map
-                    file(params.test_data['actinidia_chinensis']['genome']['genome_21_fasta_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                 ]
                 input[1] = []
                 input[2] = []
@@ -123,11 +177,10 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(process.out).match() },
-                { assert snapshot(path(process.out.versions[0]).text).match("versions_stub") }
+                { assert snapshot(process.out).match() }
             )
         }
 
     }
 
-}
\ No newline at end of file
+}
diff --git a/modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test.snap b/modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test.snap
similarity index 85%
rename from modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test.snap
rename to modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test.snap
index bcf98638..825b1e59 100644
--- a/modules/pfr/ltrretriever/ltrretriever/tests/main.nf.test.snap
+++ b/modules/gallvp/ltrretriever/ltrretriever/tests/main.nf.test.snap
@@ -1,31 +1,4 @@
 {
-    "versions_stub": {
-        "content": [
-            "\"LTRRETRIEVER_LTRRETRIEVER\":\n    LTR_retriever: v2.9.9\n"
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-19T11:04:16.007262"
-    },
-    "pass_list": {
-        "content": [
-            [
-                [
-                    {
-                        "id": "test"
-                    },
-                    "test.pass.list:md5,0c96ee3b48691e65da2235786a926160"
-                ]
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-19T11:17:50.087449"
-    },
     "versions": {
         "content": [
             "\"LTRRETRIEVER_LTRRETRIEVER\":\n    LTR_retriever: v2.9.9\n"
@@ -156,14 +129,26 @@
                     {
                         "id": "test"
                     },
-                    "test.out:md5,4ecf9226cbd7a3aaf7cf5cfa575fcc6a"
+                    "test.out:md5,33d89bea9031f25de8f0d3591ab94d87"
                 ]
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-16T14:18:02.458476"
+    },
+    "versions_no_ltr": {
+        "content": [
+            [
+                "versions.yml:md5,3ab159acaee06b342b56e2d35e5e669b"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-19T11:17:50.150622"
+        "timestamp": "2024-07-16T14:03:52.324194"
     }
-}
\ No newline at end of file
+}
diff --git a/modules/gallvp/ltrretriever/ltrretriever/tests/nextflow.config b/modules/gallvp/ltrretriever/ltrretriever/tests/nextflow.config
new file mode 100644
index 00000000..7f675565
--- /dev/null
+++ b/modules/gallvp/ltrretriever/ltrretriever/tests/nextflow.config
@@ -0,0 +1,15 @@
+process {
+
+    withName: LTRFINDER {
+        ext.args = '-harvest_out'
+        // LTRRETRIEVER_LTRRETRIEVER requires -harvest_out
+    }
+
+    withName: LTRHARVEST {
+        ext.prefix = { "${meta.id}_ltrharvest" }
+    }
+
+    withName: CAT_CAT {
+        ext.prefix = { "${meta.id}_ltrharvest_ltrfinder.tabout" }
+    }
+}
diff --git a/modules/pfr/plotsr/environment.yml b/modules/gallvp/plotsr/environment.yml
similarity index 100%
rename from modules/pfr/plotsr/environment.yml
rename to modules/gallvp/plotsr/environment.yml
diff --git a/modules/pfr/plotsr/main.nf b/modules/gallvp/plotsr/main.nf
similarity index 100%
rename from modules/pfr/plotsr/main.nf
rename to modules/gallvp/plotsr/main.nf
diff --git a/modules/pfr/plotsr/meta.yml b/modules/gallvp/plotsr/meta.yml
similarity index 100%
rename from modules/pfr/plotsr/meta.yml
rename to modules/gallvp/plotsr/meta.yml
diff --git a/modules/pfr/plotsr/tests/main.nf.test b/modules/gallvp/plotsr/tests/main.nf.test
similarity index 69%
rename from modules/pfr/plotsr/tests/main.nf.test
rename to modules/gallvp/plotsr/tests/main.nf.test
index f02b8ebf..b85b2660 100644
--- a/modules/pfr/plotsr/tests/main.nf.test
+++ b/modules/gallvp/plotsr/tests/main.nf.test
@@ -6,43 +6,44 @@ nextflow_process {
     process "PLOTSR"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "plotsr"
     tag "minimap2/align"
     tag "syri"
 
     setup {
         run("MINIMAP2_ALIGN") {
-            script "modules/pfr/minimap2/align/main.nf"
+            script "../../minimap2/align"
             process {
                 """
                 def genome2_cleanid     = file('genome2_cleanid.fasta')
-                genome2_cleanid.text    = file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true).text.replace(/>chr22:16600000-16800000/, '>chr22')
+                genome2_cleanid.text    = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true).text.replace(/>chr22:16600000-16800000/, '>chr22')
 
                 input[0] = [
                     [id: 'test'],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = [
                     [id: 'reference'],
                     genome2_cleanid
                 ]
                 input[2] = true     // bam_format
-                input[3] = false    // cigar_paf_format
-                input[4] = false    // cigar_bam
+                input[3] = 'bai'    // bam_index_extension
+                input[4] = false    // cigar_paf_format
+                input[5] = false    // cigar_bam
                 """
             }
         }
 
         run("SYRI") {
-            script "modules/pfr/syri/main.nf"
+            script "../../syri"
             process {
                 """
                 def genome2_cleanid     = file('genome2_cleanid.fasta')
-                genome2_cleanid.text    = file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true).text.replace(/>chr22:16600000-16800000/, '>chr22')
+                genome2_cleanid.text    = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true).text.replace(/>chr22:16600000-16800000/, '>chr22')
 
                 input[0] = MINIMAP2_ALIGN.out.bam
-                input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 input[2] = genome2_cleanid
                 input[3] = 'B'
                 """
@@ -59,7 +60,7 @@ nextflow_process {
 
                 input[0] = SYRI.out.syri
                 input[1] = [
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
                     genome2_cleanid
                 ]
 
@@ -94,7 +95,7 @@ nextflow_process {
 
                 input[0] = SYRI.out.syri
                 input[1] = [
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
                     genome2_cleanid
                 ]
 
diff --git a/modules/pfr/plotsr/tests/main.nf.test.snap b/modules/gallvp/plotsr/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/plotsr/tests/main.nf.test.snap
rename to modules/gallvp/plotsr/tests/main.nf.test.snap
diff --git a/modules/pfr/plotsr/tests/nextflow.config b/modules/gallvp/plotsr/tests/nextflow.config
similarity index 100%
rename from modules/pfr/plotsr/tests/nextflow.config
rename to modules/gallvp/plotsr/tests/nextflow.config
diff --git a/modules/pfr/samblaster/environment.yml b/modules/gallvp/samblaster/environment.yml
similarity index 100%
rename from modules/pfr/samblaster/environment.yml
rename to modules/gallvp/samblaster/environment.yml
diff --git a/modules/pfr/samblaster/main.nf b/modules/gallvp/samblaster/main.nf
similarity index 100%
rename from modules/pfr/samblaster/main.nf
rename to modules/gallvp/samblaster/main.nf
diff --git a/modules/pfr/samblaster/meta.yml b/modules/gallvp/samblaster/meta.yml
similarity index 100%
rename from modules/pfr/samblaster/meta.yml
rename to modules/gallvp/samblaster/meta.yml
diff --git a/modules/pfr/samblaster/tests/main.nf.test b/modules/gallvp/samblaster/tests/main.nf.test
similarity index 62%
rename from modules/pfr/samblaster/tests/main.nf.test
rename to modules/gallvp/samblaster/tests/main.nf.test
index 06bb9162..9ffac186 100644
--- a/modules/pfr/samblaster/tests/main.nf.test
+++ b/modules/gallvp/samblaster/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "SAMBLASTER"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "samblaster"
 
     test("homo_sapiens-test_paired_end_umi_unsorted_bam") {
@@ -15,7 +15,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:false ], // meta map
-                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_umi_unsorted_bam'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_unsorted.bam', checkIfExists: true)
                 ]
                 """
             }
@@ -24,7 +24,12 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(process.out).match() }
+                { assert snapshot(
+                    bam(process.out.bam[0][1]).getHeaderMD5(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
+                    process.out.versions
+                    ).match()
+                }
             )
         }
 
@@ -39,7 +44,7 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:false ], // meta map
-                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_umi_unsorted_bam'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/umi/test.paired_end.umi_unsorted.bam', checkIfExists: true)
                 ]
                 """
             }
@@ -54,4 +59,4 @@ nextflow_process {
 
     }
 
-}
\ No newline at end of file
+}
diff --git a/modules/pfr/samblaster/tests/main.nf.test.snap b/modules/gallvp/samblaster/tests/main.nf.test.snap
similarity index 56%
rename from modules/pfr/samblaster/tests/main.nf.test.snap
rename to modules/gallvp/samblaster/tests/main.nf.test.snap
index 917c8f1f..1a1481a1 100644
--- a/modules/pfr/samblaster/tests/main.nf.test.snap
+++ b/modules/gallvp/samblaster/tests/main.nf.test.snap
@@ -36,37 +36,16 @@
     },
     "homo_sapiens-test_paired_end_umi_unsorted_bam": {
         "content": [
-            {
-                "0": [
-                    [
-                        {
-                            "id": "test",
-                            "single_end": false
-                        },
-                        "test.bam:md5,634a6bd541478e970f0a4c279f399889"
-                    ]
-                ],
-                "1": [
-                    "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77"
-                ],
-                "bam": [
-                    [
-                        {
-                            "id": "test",
-                            "single_end": false
-                        },
-                        "test.bam:md5,634a6bd541478e970f0a4c279f399889"
-                    ]
-                ],
-                "versions": [
-                    "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77"
-                ]
-            }
+            "e21efac7a4734b9b16f7210901cf02af",
+            "c1b74864f32583faf7d9bcd82217ff4c",
+            [
+                "versions.yml:md5,8a70467f2dfc2e0d8e81787223d2fc77"
+            ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-26T14:04:38.118875"
+        "timestamp": "2024-07-29T20:15:04.264504"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/samblaster/tests/nextflow.config b/modules/gallvp/samblaster/tests/nextflow.config
similarity index 100%
rename from modules/pfr/samblaster/tests/nextflow.config
rename to modules/gallvp/samblaster/tests/nextflow.config
diff --git a/modules/pfr/samblaster/tests/tags.yml b/modules/gallvp/samblaster/tests/tags.yml
similarity index 100%
rename from modules/pfr/samblaster/tests/tags.yml
rename to modules/gallvp/samblaster/tests/tags.yml
diff --git a/modules/pfr/samtools/faidx/environment.yml b/modules/gallvp/samtools/faidx/environment.yml
similarity index 60%
rename from modules/pfr/samtools/faidx/environment.yml
rename to modules/gallvp/samtools/faidx/environment.yml
index 9c24eb0a..f8450fa5 100644
--- a/modules/pfr/samtools/faidx/environment.yml
+++ b/modules/gallvp/samtools/faidx/environment.yml
@@ -6,5 +6,5 @@ channels:
   - defaults
 
 dependencies:
-  - bioconda::htslib=1.19.1
-  - bioconda::samtools=1.19.2
+  - bioconda::htslib=1.20
+  - bioconda::samtools=1.20
diff --git a/modules/pfr/samtools/faidx/main.nf b/modules/gallvp/samtools/faidx/main.nf
similarity index 94%
rename from modules/pfr/samtools/faidx/main.nf
rename to modules/gallvp/samtools/faidx/main.nf
index cfe7ad95..bdcdbc95 100644
--- a/modules/pfr/samtools/faidx/main.nf
+++ b/modules/gallvp/samtools/faidx/main.nf
@@ -4,8 +4,8 @@ process SAMTOOLS_FAIDX {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' :
-        'biocontainers/samtools:1.19.2--h50ea8bc_0' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' :
+        'biocontainers/samtools:1.20--h50ea8bc_0' }"
 
     input:
     tuple val(meta), path(fasta)
diff --git a/modules/pfr/samtools/faidx/meta.yml b/modules/gallvp/samtools/faidx/meta.yml
similarity index 100%
rename from modules/pfr/samtools/faidx/meta.yml
rename to modules/gallvp/samtools/faidx/meta.yml
diff --git a/modules/pfr/samtools/faidx/tests/main.nf.test b/modules/gallvp/samtools/faidx/tests/main.nf.test
similarity index 99%
rename from modules/pfr/samtools/faidx/tests/main.nf.test
rename to modules/gallvp/samtools/faidx/tests/main.nf.test
index 17244ef2..350f26e0 100644
--- a/modules/pfr/samtools/faidx/tests/main.nf.test
+++ b/modules/gallvp/samtools/faidx/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
     process "SAMTOOLS_FAIDX"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "samtools"
     tag "samtools/faidx"
 
diff --git a/modules/pfr/samtools/faidx/tests/main.nf.test.snap b/modules/gallvp/samtools/faidx/tests/main.nf.test.snap
similarity index 86%
rename from modules/pfr/samtools/faidx/tests/main.nf.test.snap
rename to modules/gallvp/samtools/faidx/tests/main.nf.test.snap
index 3e651ef6..3223b72b 100644
--- a/modules/pfr/samtools/faidx/tests/main.nf.test.snap
+++ b/modules/gallvp/samtools/faidx/tests/main.nf.test.snap
@@ -18,7 +18,7 @@
                     
                 ],
                 "3": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ],
                 "fa": [
                     
@@ -36,7 +36,7 @@
                     
                 ],
                 "versions": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ]
             }
         ],
@@ -44,7 +44,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-03-18T16:22:39.412601"
+        "timestamp": "2024-05-28T15:42:14.779784761"
     },
     "test_samtools_faidx_bgzip": {
         "content": [
@@ -71,7 +71,7 @@
                     ]
                 ],
                 "3": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ],
                 "fa": [
                     
@@ -95,7 +95,7 @@
                     ]
                 ],
                 "versions": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ]
             }
         ],
@@ -103,7 +103,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-03-18T16:23:22.427966"
+        "timestamp": "2024-05-28T15:42:20.256633877"
     },
     "test_samtools_faidx_fasta": {
         "content": [
@@ -124,7 +124,7 @@
                     
                 ],
                 "3": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ],
                 "fa": [
                     [
@@ -142,7 +142,7 @@
                     
                 ],
                 "versions": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ]
             }
         ],
@@ -150,7 +150,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-03-18T16:24:04.107537"
+        "timestamp": "2024-05-28T15:42:25.632577273"
     },
     "test_samtools_faidx_stub_fasta": {
         "content": [
@@ -171,7 +171,7 @@
                     
                 ],
                 "3": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ],
                 "fa": [
                     [
@@ -189,7 +189,7 @@
                     
                 ],
                 "versions": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ]
             }
         ],
@@ -197,7 +197,7 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-03-18T16:24:45.868463"
+        "timestamp": "2024-05-28T15:42:31.058424849"
     },
     "test_samtools_faidx_stub_fai": {
         "content": [
@@ -218,7 +218,7 @@
                     
                 ],
                 "3": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ],
                 "fa": [
                     
@@ -236,7 +236,7 @@
                     
                 ],
                 "versions": [
-                    "versions.yml:md5,4870fc0a88c616aa937f8325a2db0c3c"
+                    "versions.yml:md5,2db78952923a61e05d50b95518b21856"
                 ]
             }
         ],
@@ -244,6 +244,6 @@
             "nf-test": "0.8.4",
             "nextflow": "23.10.1"
         },
-        "timestamp": "2024-03-18T16:25:27.550554"
+        "timestamp": "2024-05-28T15:42:36.479929617"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/samtools/faidx/tests/nextflow.config b/modules/gallvp/samtools/faidx/tests/nextflow.config
similarity index 100%
rename from modules/pfr/samtools/faidx/tests/nextflow.config
rename to modules/gallvp/samtools/faidx/tests/nextflow.config
diff --git a/modules/pfr/samtools/faidx/tests/nextflow2.config b/modules/gallvp/samtools/faidx/tests/nextflow2.config
similarity index 100%
rename from modules/pfr/samtools/faidx/tests/nextflow2.config
rename to modules/gallvp/samtools/faidx/tests/nextflow2.config
diff --git a/modules/pfr/samtools/faidx/tests/tags.yml b/modules/gallvp/samtools/faidx/tests/tags.yml
similarity index 100%
rename from modules/pfr/samtools/faidx/tests/tags.yml
rename to modules/gallvp/samtools/faidx/tests/tags.yml
diff --git a/modules/gallvp/seqkit/seq/environment.yml b/modules/gallvp/seqkit/seq/environment.yml
new file mode 100644
index 00000000..74e0dd76
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/environment.yml
@@ -0,0 +1,9 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+name: "seqkit_seq"
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - "bioconda::seqkit=2.8.1"
diff --git a/modules/gallvp/seqkit/seq/main.nf b/modules/gallvp/seqkit/seq/main.nf
new file mode 100644
index 00000000..d7d38fc8
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/main.nf
@@ -0,0 +1,63 @@
+process SEQKIT_SEQ {
+    tag "$meta.id"
+    label 'process_low'
+    // File IO can be a bottleneck. See: https://bioinf.shenwei.me/seqkit/usage/#parallelization-of-cpu-intensive-jobs
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/seqkit:2.8.1--h9ee0642_0':
+        'biocontainers/seqkit:2.8.1--h9ee0642_0' }"
+
+    input:
+    tuple val(meta), path(fastx)
+
+    output:
+    tuple val(meta), path("${prefix}.*")    , emit: fastx
+    path "versions.yml"                     , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args        = task.ext.args ?: ''
+    def args2       = task.ext.args2 ?: ''
+    prefix          = task.ext.prefix ?: "${meta.id}"
+    def extension   = "fastq"
+    if ("$fastx" ==~ /.+\.fasta|.+\.fasta.gz|.+\.fa|.+\.fa.gz|.+\.fas|.+\.fas.gz|.+\.fna|.+\.fna.gz|.+\.fsa|.+\.fsa.gz/ ) {
+        extension   = "fasta"
+    }
+    extension       = fastx.toString().endsWith('.gz') ? "${extension}.gz" : extension
+    def call_gzip   = extension.endsWith('.gz') ? "| gzip -c $args2" : ''
+    if("${prefix}.${extension}" == "$fastx") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+    """
+    seqkit \\
+        seq \\
+        --threads $task.cpus \\
+        $args \\
+        $fastx \\
+        $call_gzip \\
+        > ${prefix}.${extension}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        seqkit: \$(seqkit version | cut -d' ' -f2)
+    END_VERSIONS
+    """
+
+    stub:
+    prefix          = task.ext.prefix ?: "${meta.id}"
+    def extension   = "fastq"
+    if ("$fastx" ==~ /.+\.fasta|.+\.fasta.gz|.+\.fa|.+\.fa.gz|.+\.fas|.+\.fas.gz|.+\.fna|.+\.fna.gz|.+\.fsa|.+\.fsa.gz/ ) {
+        extension   = "fasta"
+    }
+    extension = fastx.toString().endsWith('.gz') ? "${extension}.gz" : extension
+    if("${prefix}.${extension}" == "$fastx") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+    """
+    touch ${prefix}.${extension}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        seqkit: \$(seqkit version | cut -d' ' -f2)
+    END_VERSIONS
+    """
+}
diff --git a/modules/gallvp/seqkit/seq/meta.yml b/modules/gallvp/seqkit/seq/meta.yml
new file mode 100644
index 00000000..8d4e2b16
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/meta.yml
@@ -0,0 +1,48 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
+name: "seqkit_seq"
+description: Transforms sequences (extract ID, filter by length, remove gaps, reverse complement...)
+keywords:
+  - genomics
+  - fasta
+  - fastq
+  - transform
+  - filter
+  - gaps
+  - complement
+tools:
+  - "seqkit":
+      description: "A cross-platform and ultrafast toolkit for FASTA/Q file manipulation"
+      homepage: "https://bioinf.shenwei.me/seqkit/"
+      documentation: "https://bioinf.shenwei.me/seqkit/usage/"
+      tool_dev_url: "https://github.com/shenwei356/seqkit"
+      doi: "10.1371/journal.pone.0163962"
+      licence: ["MIT"]
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. `[ id:'sample1' ]`
+  - fastx:
+      type: file
+      description: Input fasta/fastq file
+      pattern: "*.{fsa,fas,fa,fasta,fastq,fq,fsa.gz,fas.gz,fa.gz,fasta.gz,fastq.gz,fq.gz}"
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. `[ id:'sample1' ]`
+  - fastx:
+      type: file
+      description: Output fasta/fastq file
+      pattern: "*.{fasta,fasta.gz,fastq,fastq.gz}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@GallVp"
+maintainers:
+  - "@GallVp"
diff --git a/modules/gallvp/seqkit/seq/tests/main.nf.test b/modules/gallvp/seqkit/seq/tests/main.nf.test
new file mode 100644
index 00000000..cff90067
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/tests/main.nf.test
@@ -0,0 +1,145 @@
+nextflow_process {
+
+    name "Test Process SEQKIT_SEQ"
+    script "../main.nf"
+    process "SEQKIT_SEQ"
+    config './nextflow.config'
+
+    tag "modules"
+    tag "modules_gallvp"
+    tag "seqkit"
+    tag "seqkit/seq"
+
+    test("sarscov2-genome_fasta") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
+
+    }
+
+    test("sarscov2-genome_fasta_gz") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
+
+    }
+
+    test("sarscov2-test_1_fastq_gz") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
+
+    }
+
+    test("file_name_conflict-fail_with_error") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test_1' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert !process.success },
+                { assert process.stdout.toString().contains("Input and output names are the same") }
+            )
+        }
+
+    }
+
+    test("sarscov2-genome_fasta-stub") {
+
+        options '-stub'
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
+
+    }
+
+    test("file_name_conflict-fail_with_error-stub") {
+
+        options '-stub'
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'genome' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert !process.success },
+                { assert process.stdout.toString().contains("Input and output names are the same") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/gallvp/seqkit/seq/tests/main.nf.test.snap b/modules/gallvp/seqkit/seq/tests/main.nf.test.snap
new file mode 100644
index 00000000..e6910966
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/tests/main.nf.test.snap
@@ -0,0 +1,134 @@
+{
+    "sarscov2-genome_fasta-stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ],
+                "fastx": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "23.10.1"
+        },
+        "timestamp": "2024-05-08T08:52:18.220051903"
+    },
+    "sarscov2-test_1_fastq_gz": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ],
+                "fastx": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "23.10.1"
+        },
+        "timestamp": "2024-05-08T08:51:55.607826581"
+    },
+    "sarscov2-genome_fasta": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta:md5,483f4a5dfe60171c86ee9b7e6dff908b"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ],
+                "fastx": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta:md5,483f4a5dfe60171c86ee9b7e6dff908b"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "23.10.1"
+        },
+        "timestamp": "2024-05-08T08:51:27.717072933"
+    },
+    "sarscov2-genome_fasta_gz": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta.gz:md5,483f4a5dfe60171c86ee9b7e6dff908b"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ],
+                "fastx": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.fasta.gz:md5,483f4a5dfe60171c86ee9b7e6dff908b"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,34894c4efa5e10a923e78975a3d260dd"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "23.10.1"
+        },
+        "timestamp": "2024-05-08T08:51:37.917560104"
+    }
+}
\ No newline at end of file
diff --git a/modules/gallvp/seqkit/seq/tests/nextflow.config b/modules/gallvp/seqkit/seq/tests/nextflow.config
new file mode 100644
index 00000000..d8e3c66a
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/tests/nextflow.config
@@ -0,0 +1,3 @@
+process {
+    ext.args2 = '-n'
+}
diff --git a/modules/gallvp/seqkit/seq/tests/tags.yml b/modules/gallvp/seqkit/seq/tests/tags.yml
new file mode 100644
index 00000000..5eeca7e3
--- /dev/null
+++ b/modules/gallvp/seqkit/seq/tests/tags.yml
@@ -0,0 +1,2 @@
+seqkit/seq:
+  - "modules/nf-core/seqkit/seq/**"
diff --git a/modules/pfr/syri/environment.yml b/modules/gallvp/syri/environment.yml
similarity index 88%
rename from modules/pfr/syri/environment.yml
rename to modules/gallvp/syri/environment.yml
index 45eafb1f..0a34f206 100644
--- a/modules/pfr/syri/environment.yml
+++ b/modules/gallvp/syri/environment.yml
@@ -6,4 +6,4 @@ channels:
   - bioconda
   - defaults
 dependencies:
-  - "bioconda::syri=1.6.3"
+  - "bioconda::syri=1.7.0"
diff --git a/modules/pfr/syri/main.nf b/modules/gallvp/syri/main.nf
similarity index 92%
rename from modules/pfr/syri/main.nf
rename to modules/gallvp/syri/main.nf
index 0a10ae19..655018b5 100644
--- a/modules/pfr/syri/main.nf
+++ b/modules/gallvp/syri/main.nf
@@ -4,8 +4,8 @@ process SYRI {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/syri:1.6.3--py38hdbdd923_2':
-        'biocontainers/syri:1.6.3--py38hdbdd923_2' }"
+        'https://depot.galaxyproject.org/singularity/syri:1.7.0--py310hdbdd923_0':
+        'biocontainers/syri:1.7.0--py310hdbdd923_0' }"
 
     input:
     tuple val(meta), path(infile)
diff --git a/modules/pfr/syri/meta.yml b/modules/gallvp/syri/meta.yml
similarity index 100%
rename from modules/pfr/syri/meta.yml
rename to modules/gallvp/syri/meta.yml
diff --git a/modules/pfr/syri/tests/main.nf.test b/modules/gallvp/syri/tests/main.nf.test
similarity index 56%
rename from modules/pfr/syri/tests/main.nf.test
rename to modules/gallvp/syri/tests/main.nf.test
index baa8555c..27f4f8b3 100644
--- a/modules/pfr/syri/tests/main.nf.test
+++ b/modules/gallvp/syri/tests/main.nf.test
@@ -6,26 +6,27 @@ nextflow_process {
     process "SYRI"
 
     tag "modules"
-    tag "modules_nfcore"
+    tag "modules_gallvp"
     tag "syri"
     tag "minimap2/align"
 
     setup {
         run("MINIMAP2_ALIGN") {
-            script "modules/pfr/minimap2/align/main.nf"
+            script "../../minimap2/align"
             process {
                 """
                 input[0] = [
                     [id: 'test'],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[1] = [
                     [id: 'reference'],
-                    file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true)
                 ]
                 input[2] = true     // bam_format
-                input[3] = false    // cigar_paf_format
-                input[4] = false    // cigar_bam
+                input[3] = 'bai'    // bam_index_extension
+                input[4] = false    // cigar_paf_format
+                input[5] = false    // cigar_bam
                 """
             }
         }
@@ -37,8 +38,8 @@ nextflow_process {
             process {
                 """
                 input[0] = MINIMAP2_ALIGN.out.bam
-                input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
-                input[2] = file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true)
+                input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+                input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true)
                 input[3] = 'B'
                 """
             }
@@ -61,8 +62,8 @@ nextflow_process {
             process {
                 """
                 input[0] = MINIMAP2_ALIGN.out.bam
-                input[1] = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
-                input[2] = file(params.test_data['homo_sapiens']['genome']['genome2_fasta'], checkIfExists: true)
+                input[1] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+                input[2] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true)
                 input[3] = 'B'
                 """
             }
diff --git a/modules/pfr/syri/tests/main.nf.test.snap b/modules/gallvp/syri/tests/main.nf.test.snap
similarity index 79%
rename from modules/pfr/syri/tests/main.nf.test.snap
rename to modules/gallvp/syri/tests/main.nf.test.snap
index 8d09bf33..dd39565b 100644
--- a/modules/pfr/syri/tests/main.nf.test.snap
+++ b/modules/gallvp/syri/tests/main.nf.test.snap
@@ -14,7 +14,7 @@
                     
                 ],
                 "2": [
-                    "versions.yml:md5,05cf55e24c29c2661a2b9301d3c7c2a0"
+                    "versions.yml:md5,0c85b0fa3d80a73807daf08b7e4c51f6"
                 ],
                 "error": [
                     
@@ -28,15 +28,15 @@
                     ]
                 ],
                 "versions": [
-                    "versions.yml:md5,05cf55e24c29c2661a2b9301d3c7c2a0"
+                    "versions.yml:md5,0c85b0fa3d80a73807daf08b7e4c51f6"
                 ]
             }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-25T21:30:50.653501"
+        "timestamp": "2024-07-22T14:11:06.589243"
     },
     "homo_sapiens - genome - stub": {
         "content": [
@@ -53,7 +53,7 @@
                     
                 ],
                 "2": [
-                    "versions.yml:md5,05cf55e24c29c2661a2b9301d3c7c2a0"
+                    "versions.yml:md5,0c85b0fa3d80a73807daf08b7e4c51f6"
                 ],
                 "error": [
                     
@@ -67,14 +67,14 @@
                     ]
                 ],
                 "versions": [
-                    "versions.yml:md5,05cf55e24c29c2661a2b9301d3c7c2a0"
+                    "versions.yml:md5,0c85b0fa3d80a73807daf08b7e4c51f6"
                 ]
             }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-25T21:22:31.028411"
+        "timestamp": "2024-07-22T14:11:12.583161"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/syri/tests/nextflow.config b/modules/gallvp/syri/tests/nextflow.config
similarity index 100%
rename from modules/pfr/syri/tests/nextflow.config
rename to modules/gallvp/syri/tests/nextflow.config
diff --git a/modules/local/assemblathon_stats.nf b/modules/local/assemblathon_stats.nf
index 3ef37de5..363a0e21 100644
--- a/modules/local/assemblathon_stats.nf
+++ b/modules/local/assemblathon_stats.nf
@@ -28,7 +28,7 @@ process ASSEMBLATHON_STATS {
         | xargs
     )
 
-    falite_path="\$(find \$paths_to_check -name FAlite_a93cba2.pm)"
+    falite_path="\$(find \$paths_to_check -name FAlite_a93cba2.pm | head -n 1)"
 
     ln -s "\$falite_path" FAlite_a93cba2.pm
 
diff --git a/modules/local/ncbi_fcs_gx_screen_samples.nf b/modules/local/ncbi_fcs_gx_screen_samples.nf
index f9ed5cc8..24276f61 100644
--- a/modules/local/ncbi_fcs_gx_screen_samples.nf
+++ b/modules/local/ncbi_fcs_gx_screen_samples.nf
@@ -2,10 +2,10 @@ process NCBI_FCS_GX_SCREEN_SAMPLES {
     tag 'all samples'
     label 'process_high'
 
-    conda "bioconda::ncbi-fcs-gx=0.5.0"
+    conda "bioconda::ncbi-fcs-gx=0.5.4"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/ncbi-fcs-gx:0.5.0--h4ac6f70_3':
-        'biocontainers/ncbi-fcs-gx:0.5.0--h4ac6f70_3' }"
+        'https://depot.galaxyproject.org/singularity/ncbi-fcs-gx:0.5.4--h4ac6f70_0':
+        'biocontainers/ncbi-fcs-gx:0.5.4--h4ac6f70_0' }"
 
     input:
     path samples
@@ -21,12 +21,20 @@ process NCBI_FCS_GX_SCREEN_SAMPLES {
     task.ext.when == null || task.ext.when
 
     script:
-    def VERSION = 0.5
+    def VERSION = '0.5.4'
     """
+    export GX_NUM_CORES=$task.cpus
+
     for sample_fasta in $samples;
     do
         sample_tag=\$(echo "\$sample_fasta" | sed 's/fasta.file.for.//g' | sed 's/.fasta//g')
-        run_gx.py --fasta ./\$sample_fasta --out-dir ./ --gx-db $db_path --tax-id "${tax_id}"
+
+        run_gx.py \\
+            --fasta ./\$sample_fasta \\
+            --out-dir ./ \\
+            --gx-db $db_path \\
+            --tax-id "${tax_id}" \\
+            --phone-home-label github/$workflow.manifest.name
 
         mv "\${sample_fasta%.fasta}.${tax_id}.fcs_gx_report.txt" "\${sample_tag}.fcs_gx_report.txt"
         mv "\${sample_fasta%.fasta}.${tax_id}.taxonomy.rpt" "\${sample_tag}.taxonomy.rpt"
@@ -39,7 +47,7 @@ process NCBI_FCS_GX_SCREEN_SAMPLES {
     """
 
     stub:
-    def VERSION = 0.5
+    def VERSION = '0.5.4'
     """
     for sample_fasta in $samples;
     do
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
index 4fc19b74..e1b9f565 100644
--- a/modules/nf-core/fastp/main.nf
+++ b/modules/nf-core/fastp/main.nf
@@ -10,6 +10,7 @@ process FASTP {
     input:
     tuple val(meta), path(reads)
     path  adapter_fasta
+    val   discard_trimmed_pass
     val   save_trimmed_fail
     val   save_merged
 
@@ -18,9 +19,9 @@ process FASTP {
     tuple val(meta), path('*.json')           , emit: json
     tuple val(meta), path('*.html')           , emit: html
     tuple val(meta), path('*.log')            , emit: log
-    path "versions.yml"                       , emit: versions
     tuple val(meta), path('*.fail.fastq.gz')  , optional:true, emit: reads_fail
     tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged
+    path "versions.yml"                       , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -30,6 +31,8 @@ process FASTP {
     def prefix = task.ext.prefix ?: "${meta.id}"
     def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : ""
     def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : ''
+    def out_fq1 = discard_trimmed_pass ?: ( meta.single_end ? "--out1 ${prefix}.fastp.fastq.gz" : "--out1 ${prefix}_1.fastp.fastq.gz" )
+    def out_fq2 = discard_trimmed_pass ?: "--out2 ${prefix}_2.fastp.fastq.gz"
     // Added soft-links to original fastqs for consistent naming in MultiQC
     // Use single ended for interleaved. Add --interleaved_in in config.
     if ( task.ext.args?.contains('--interleaved_in') ) {
@@ -59,7 +62,7 @@ process FASTP {
 
         fastp \\
             --in1 ${prefix}.fastq.gz \\
-            --out1  ${prefix}.fastp.fastq.gz \\
+            $out_fq1 \\
             --thread $task.cpus \\
             --json ${prefix}.fastp.json \\
             --html ${prefix}.fastp.html \\
@@ -81,8 +84,8 @@ process FASTP {
         fastp \\
             --in1 ${prefix}_1.fastq.gz \\
             --in2 ${prefix}_2.fastq.gz \\
-            --out1 ${prefix}_1.fastp.fastq.gz \\
-            --out2 ${prefix}_2.fastp.fastq.gz \\
+            $out_fq1 \\
+            $out_fq2 \\
             --json ${prefix}.fastp.json \\
             --html ${prefix}.fastp.html \\
             $adapter_list \\
@@ -103,14 +106,16 @@ process FASTP {
     stub:
     def prefix              = task.ext.prefix ?: "${meta.id}"
     def is_single_output    = task.ext.args?.contains('--interleaved_in') || meta.single_end
-    def touch_reads         = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz"
-    def touch_merged        = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : ""
+    def touch_reads         = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz"
+    def touch_merged        = (!is_single_output && save_merged) ? "echo '' | gzip >  ${prefix}.merged.fastq.gz" : ""
+    def touch_fail_fastq    = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz"
     """
-    touch $touch_reads
+    $touch_reads
+    $touch_fail_fastq
+    $touch_merged
     touch "${prefix}.fastp.json"
     touch "${prefix}.fastp.html"
     touch "${prefix}.fastp.log"
-    $touch_merged
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml
index c22a16ab..8dfecc18 100644
--- a/modules/nf-core/fastp/meta.yml
+++ b/modules/nf-core/fastp/meta.yml
@@ -27,12 +27,16 @@ input:
       type: file
       description: File in FASTA format containing possible adapters to remove.
       pattern: "*.{fasta,fna,fas,fa}"
+  - discard_trimmed_pass:
+      type: boolean
+      description: Specify true to not write any reads that pass trimming thresholds. |
+        This can be used to use fastp for the output report only.
   - save_trimmed_fail:
       type: boolean
       description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz`
   - save_merged:
       type: boolean
-      description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz`
+      description: Specify true to save all merged reads to a file ending in `*.merged.fastq.gz`
 output:
   - meta:
       type: map
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
index 6f1f4897..30dbb8aa 100644
--- a/modules/nf-core/fastp/tests/main.nf.test
+++ b/modules/nf-core/fastp/tests/main.nf.test
@@ -10,221 +10,290 @@ nextflow_process {
     test("test_fastp_single_end") {
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
+
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = false
-
                 input[0] = Channel.of([
                     [ id:'test', single_end:true ],
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
                 """
             }
         }
 
         then {
-            def html_text  = [ "Q20 bases:</td><td class='col2'>12.922000 K (92.984097%)",
-                                "single end (151 cycles)" ]
-            def log_text   = [ "Q20 bases: 12922(92.9841%)",
-								"reads passed filter: 99" ]
-            def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
-								"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
-								"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
-								"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
-								"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-								"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
             assertAll(
                 { assert process.success },
-                { read_lines.each { read_line ->
-                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { assert snapshot(process.out.json).match("test_fastp_single_end_json") },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { file(it[1]).getName() } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_single_end-_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_single_end") }
+                { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
             )
         }
     }
 
-    test("test_fastp_single_end-stub") {
-
-        options '-stub'
+    test("test_fastp_paired_end") {
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
+
             process {
                 """
                 adapter_fasta     = []
+                save_trimmed_pass = true
                 save_trimmed_fail = false
                 save_merged       = false
 
                 input[0] = Channel.of([
-                    [ id:'test', single_end:true ],
-                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
                 """
             }
         }
 
         then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
+            )
+        }
+    }
 
+    test("fastp test_fastp_interleaved") {
+
+        config './nextflow.interleaved.config'
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
+                """
+            }
+        }
+
+        then {
             assertAll(
                 { assert process.success },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { file(it[1]).getName() } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_single_end-for_stub_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_single_end_stub") }
+                { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
+                { assert process.out.reads_fail == [] },
+                { assert process.out.reads_merged == [] },
+                { assert snapshot(
+                    process.out.reads,
+                    process.out.json,
+                    process.out.versions).match() }
             )
         }
     }
 
-    test("test_fastp_paired_end") {
+    test("test_fastp_single_end_trim_fail") {
 
         when {
-            params {
-                outdir   = "$outputDir"
+
+            process {
+                """
+                input[0] = Channel.of([
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] = []
+                input[2] = false
+                input[3] = true
+                input[4] = false
+                """
             }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_trim_fail") {
+
+        config './nextflow.save_failed.config'
+        when {
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = false
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+                ])
+                input[1] = []
+                input[2] = false
+                input[3] = true
+                input[4] = false
+                """
+            }
+        }
 
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
+                { assert snapshot(
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.json,
+                    process.out.versions).match() }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_merged") {
+
+        when {
+            process {
+                """
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = true
                 """
             }
         }
 
         then {
-            def html_text   = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
-									"The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
-            def log_text    = [ "No adapter detected for read1",
-									"Q30 bases: 12281(88.3716%)"]
-            def json_text   = ['"passed_filter_reads": 198']
-            def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
-									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
-            def read2_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
-									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
-									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
-									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
-									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
             assertAll(
                 { assert process.success },
-                { read1_lines.each { read1_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
-                    }
-                },
-                { read2_lines.each { read2_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { json_text.each { json_part ->
-                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
-                    }
-                },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_paired_end_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end") }
+                { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.versions).match() },
             )
         }
     }
 
-    test("test_fastp_paired_end-stub") {
-
-        options '-stub'
+    test("test_fastp_paired_end_merged_adapterlist") {
 
         when {
-            params {
-                outdir   = "$outputDir"
+            process {
+                """
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] =  Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
+                input[2] = false
+                input[3] = false
+                input[4] = true
+                """
             }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.html.get(0).get(1)).getText().contains("<div id='After_filtering__merged__quality'>") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
+            )
+        }
+    }
+
+    test("test_fastp_single_end_qc_only") {
+
+        when {
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = false
+                input[0] = Channel.of([
+                    [ id:'test', single_end:true ],
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] = []
+                input[2] = true
+                input[3] = false
+                input[4] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
+            )
+        }
+    }
 
+    test("test_fastp_paired_end_qc_only") {
+
+        when {
+            process {
+                """
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = true
+                input[3] = false
+                input[4] = false
                 """
             }
         }
@@ -232,114 +301,99 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_paired_end-for_stub_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end-stub") }
+                { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+                { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
+                { assert snapshot(
+                    process.out.json,
+                    process.out.reads,
+                    process.out.reads,
+                    process.out.reads_fail,
+                    process.out.reads_fail,
+                    process.out.reads_merged,
+                    process.out.reads_merged,
+                    process.out.versions).match() }
             )
         }
     }
 
-    test("fastp test_fastp_interleaved") {
+    test("test_fastp_single_end - stub") {
+
+        options "-stub"
 
-        config './nextflow.interleaved.config'
         when {
-            params {
-                outdir   = "$outputDir"
+
+            process {
+                """
+                input[0] = Channel.of([
+                    [ id:'test', single_end:true ],
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
+                """
             }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end - stub") {
+
+        options "-stub"
+
+        when {
+
             process {
                 """
                 adapter_fasta     = []
+                save_trimmed_pass = true
                 save_trimmed_fail = false
                 save_merged       = false
 
                 input[0] = Channel.of([
-                    [ id:'test', single_end:true ], // meta map
-                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
                 """
             }
         }
 
         then {
-            def html_text  = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
-									"paired end (151 cycles + 151 cycles)"]
-            def log_text   = [ "Q20 bases: 12922(92.9841%)",
-									"reads passed filter: 162"]
-            def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
-									"@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
-									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
-									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE"]
             assertAll(
                 { assert process.success },
-                { read_lines.each { read_line ->
-                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { file(it[1]).getName() } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_interleaved-_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_interleaved") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("fastp test_fastp_interleaved-stub") {
+    test("fastp - stub test_fastp_interleaved") {
 
-        options '-stub'
+        options "-stub"
 
         config './nextflow.interleaved.config'
         when {
-            params {
-                outdir   = "$outputDir"
-            }
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = false
-
                 input[0] = Channel.of([
                     [ id:'test', single_end:true ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = false
                 """
             }
         }
@@ -347,277 +401,112 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { file(it[1]).getName() } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_interleaved-for_stub_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_interleaved-stub") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("test_fastp_single_end_trim_fail") {
+    test("test_fastp_single_end_trim_fail - stub") {
+
+        options "-stub"
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
+
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = true
-                save_merged       = false
-
                 input[0] = Channel.of([
                     [ id:'test', single_end:true ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = true
+                input[4] = false
                 """
             }
         }
 
         then {
-            def html_text         = [ "Q20 bases:</td><td class='col2'>12.922000 K (92.984097%)",
-									"single end (151 cycles)"]
-            def log_text          = [ "Q20 bases: 12922(92.9841%)",
-									"reads passed filter: 99" ]
-            def read_lines        = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
-									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
-            def failed_read_lines = [ "@ERR5069949.885966 NS500628:121:HK3MMAFX2:4:11610:19682:20132/1 failed_quality_filter",
-									"GTCTAATCATAATTTCTTGGTACAGGCTGGTATTGTTCATCTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTT",
-									"AAA//E/EAA/E//E//E//E/E//AE/A/E//EAEA///AE//E///E/EEE6EEEAEEA///E/AEE/EAEE/E//E"]
             assertAll(
                 { assert process.success },
-                { read_lines.each { read_line ->
-                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
-                    }
-                },
-                { failed_read_lines.each { failed_read_line ->
-                    { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("test_fastp_paired_end_trim_fail") {
+    test("test_fastp_paired_end_trim_fail - stub") {
+
+        options "-stub"
 
         config './nextflow.save_failed.config'
         when {
-            params {
-                outdir   = "$outputDir"
-            }
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = true
-                save_merged       = false
-
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = true
+                input[4] = false
                 """
             }
         }
 
         then {
-            def html_text           = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
-									"The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
-            def log_text            = [ "No adapter detected for read1",
-									"Q30 bases: 12281(88.3716%)"]
-            def json_text           = ['"passed_filter_reads": 162']
-            def read1_lines         = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
-									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
-            def read2_lines         = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
-									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
-									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
-									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
-									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
-            def failed_read2_lines  = ["@ERR5069949.973930 NS500628:121:HK3MMAFX2:2:21105:5548:5659/2",
-									"CCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAG",
-									"AAAAAEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEAE<EAEEEEEEAEEAEE"]
-            // def failed_read1_lines = path(process.out.reads_fail.get(0).get(1).get(0)).linesGzip is empty file
             assertAll(
                 { assert process.success },
-                { assert path(process.out.reads_fail.get(0).get(1).get(0)).exists() },
-                { read1_lines.each { read1_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
-                    }
-                },
-                { read2_lines.each { read2_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
-                    }
-                },
-                { failed_read2_lines.each { failed_read2_line ->
-                    { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { json_text.each { json_part ->
-                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
-                    }
-                },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("test_fastp_paired_end_merged") {
+    test("test_fastp_paired_end_merged - stub") {
+
+        options "-stub"
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = true
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = false
+                input[3] = false
+                input[4] = true
                 """
             }
         }
 
         then {
-            def html_text         = [ "<div id='After_filtering__merged__quality'>"]
-            def log_text          = [ "Merged and filtered:",
-									"total reads: 75",
-									"total bases: 13683"]
-            def json_text         = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683']
-            def read1_lines       = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
-									"CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
-									"AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE<AEEAEEEAEAEEEAEAEEAE/AEEEEAEEEEAEA",
-									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/1",
-									"CACAAACTCTAAAAGAATGTATAGGGTCAGCACCAAAAATACCAGCAGATAATAATGTTGCAAGTAGAACTTCGTGCAGATTAAAATTTTCATAAGCACTCTAAAGAAGTTGAATGTCTTCAAATTTCTTAACATTAGGGCCCACAACAAG",
-									"AAAAAEA/A<EAA/AE/EE/EE//////EA/EEE/E/EEEE//E/6//EA//<AA/A/EEEAA/EEEE/EEEA/E/</AEE////AEEEE//<E//EAE/A///<EEE//<E<<EEE<///A//E/E/EEEAA/<A////<A/AEAAA//E"]
-            def read2_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/2",
-									"GTACAAAAATAGCCTAAGAAACAATAAACTAGCATTATACACTGAAGTGTATTACCAGTTATGAAGAAAATAGGGCAATACTCAACACACATAAAAACAATACCTCTGGCCAAAAACATGACAGTTGTAACTACACCTGAGTAGTTAGAAG",
-									"AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEA/EAA</EEEEEEEEEE/AE//A/E<AE<AA<AEEE/AAEAAAEEAEEA<A6AEEA<EEAEEEEEEEAA//EE",
-									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/2",
-									"ATGAATCTGATGAATACATAGCTACTAATGGACCTCTTAAAGTGCGTGGTAGTTGTGATTAAAGCGGACACATACTTGCTAAACACTCTCTTCATGATGTC",
-									"A/AAAEEEEA6AA6EE//EEA/EEEAE/EA/A////E</EEAA//EEA////EAE<///E/AEA</AAE/EA//E<EAAAE/AA//AEE//A/AE//</EE"]
-            def read_merged_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1 merged_150_37",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGTGGTGCAGGTAATTGAGCAGGGTCGCCAATGTACACAT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAAEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEAAAAA",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1 merged_77_0",
-									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
             assertAll(
                 { assert process.success },
-                { read1_lines.each { read1_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
-                    }
-                },
-                { read2_lines.each { read2_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
-                    }
-                },
-                { read_merged_lines.each { read_merged_line ->
-                    { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { json_text.each { json_part ->
-                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
-                    }
-                },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_paired_end_merged_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end_merged") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("test_fastp_paired_end_merged-stub") {
+    test("test_fastp_paired_end_merged_adapterlist - stub") {
 
-        options '-stub'
+        options "-stub"
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
             process {
                 """
-                adapter_fasta     = []
-                save_trimmed_fail = false
-                save_merged       = true
-
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] =  Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
+                input[2] = false
+                input[3] = false
+                input[4] = true
                 """
             }
         }
@@ -625,101 +514,63 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                {
-                    assert snapshot(
-                        (
-                            [process.out.reads[0][0].toString()] + // meta
-                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
-                            process.out.json.collect { file(it[1]).getName() } +
-                            process.out.html.collect { file(it[1]).getName() } +
-                            process.out.log.collect { file(it[1]).getName() } +
-                            process.out.reads_fail.collect { file(it[1]).getName() } +
-                            process.out.reads_merged.collect { file(it[1]).getName() }
-                        ).sort()
-                    ).match("test_fastp_paired_end_merged-for_stub_match")
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
-    test("test_fastp_paired_end_merged_adapterlist") {
+    test("test_fastp_single_end_qc_only - stub") {
+
+        options "-stub"
 
         when {
-            params {
-                outdir   = "$outputDir"
-            }
             process {
                 """
-                adapter_fasta     = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
-                save_trimmed_fail = false
-                save_merged       = true
+                input[0] = Channel.of([
+                    [ id:'test', single_end:true ],
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+                ])
+                input[1] = []
+                input[2] = true
+                input[3] = false
+                input[4] = false
+                """
+            }
+        }
 
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_qc_only - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
                 input[0] = Channel.of([
                     [ id:'test', single_end:false ], // meta map
                     [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                     file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
                 ])
-                input[1] = adapter_fasta
-                input[2] = save_trimmed_fail
-                input[3] = save_merged
+                input[1] = []
+                input[2] = true
+                input[3] = false
+                input[4] = false
                 """
             }
         }
 
         then {
-            def html_text         = [ "<div id='After_filtering__merged__quality'>"]
-            def log_text          = [ "Merged and filtered:",
-									"total reads: 75",
-									"total bases: 13683"]
-            def json_text         = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"]
-            def read1_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
-									"CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
-									"AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE<AEEAEEEAEAEEEAEAEEAE/AEEEEAEEEEAEA",
-									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/1",
-									"CACAAACTCTAAAAGAATGTATAGGGTCAGCACCAAAAATACCAGCAGATAATAATGTTGCAAGTAGAACTTCGTGCAGATTAAAATTTTCATAAGCACTCTAAAGAAGTTGAATGTCTTCAAATTTCTTAACATTAGGGCCCACAACAAG",
-									"AAAAAEA/A<EAA/AE/EE/EE//////EA/EEE/E/EEEE//E/6//EA//<AA/A/EEEAA/EEEE/EEEA/E/</AEE////AEEEE//<E//EAE/A///<EEE//<E<<EEE<///A//E/E/EEEAA/<A////<A/AEAAA//E"]
-            def read2_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/2",
-									"GTACAAAAATAGCCTAAGAAACAATAAACTAGCATTATACACTGAAGTGTATTACCAGTTATGAAGAAAATAGGGCAATACTCAACACACATAAAAACAATACCTCTGGCCAAAAACATGACAGTTGTAACTACACCTGAGTAGTTAGAAG",
-									"AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEA/EAA</EEEEEEEEEE/AE//A/E<AE<AA<AEEE/AAEAAAEEAEEA<A6AEEA<EEAEEEEEEEAA//EE",
-									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/2",
-									"ATGAATCTGATGAATACATAGCTACTAATGGACCTCTTAAAGTGCGTGGTAGTTGTGATTAAAGCGGACACATACTTGCTAAACACTCTCTTCATGATGTC",
-									"A/AAAEEEEA6AA6EE//EEA/EEEAE/EA/A////E</EEAA//EEA////EAE<///E/AEA</AAE/EA//E<EAAAE/AA//AEE//A/AE//</EE"]
-            def read_merged_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1 merged_150_37",
-									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGTGGTGCAGGTAATTGAGCAGGGTCGCCAATGTACACAT",
-									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAAEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEAAAAA",
-									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1 merged_77_0",
-									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
-									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
-
             assertAll(
                 { assert process.success },
-                { read1_lines.each { read1_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
-                    }
-                },
-                { read2_lines.each { read2_line ->
-                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
-                    }
-                },
-                { read_merged_lines.each { read_merged_line ->
-                    { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
-                    }
-                },
-                { html_text.each { html_part ->
-                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
-                    }
-                },
-                { json_text.each { json_part ->
-                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
-                    }
-                },
-                { log_text.each { log_part ->
-                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
-                    }
-                },
-                { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") }
+                { assert snapshot(process.out).match() }
             )
         }
     }
-}
+}
\ No newline at end of file
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
index 3e876288..54be7e45 100644
--- a/modules/nf-core/fastp/tests/main.nf.test.snap
+++ b/modules/nf-core/fastp/tests/main.nf.test.snap
@@ -1,55 +1,178 @@
 {
-    "fastp test_fastp_interleaved_json": {
+    "test_fastp_single_end_qc_only - stub": {
         "content": [
-            [
-                [
-                    {
-                        "id": "test",
-                        "single_end": true
-                    },
-                    "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22"
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
                 ]
-            ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-03-18T16:19:15.063001"
+        "timestamp": "2024-07-05T14:31:10.841098"
     },
-    "test_fastp_paired_end_merged-for_stub_match": {
+    "test_fastp_paired_end": {
         "content": [
             [
                 [
-                    "test_1.fastp.fastq.gz",
-                    "test_2.fastp.fastq.gz"
-                ],
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "test.merged.fastq.gz",
-                "{id=test, single_end=false}"
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-01-17T18:10:13.467574"
+        "timestamp": "2024-07-05T13:43:28.665779"
     },
-    "versions_interleaved": {
+    "test_fastp_paired_end_merged_adapterlist": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:56:24.615634793"
+        "timestamp": "2024-07-05T13:44:18.210375"
     },
-    "test_fastp_single_end_json": {
+    "test_fastp_single_end_qc_only": {
         "content": [
             [
                 [
@@ -57,274 +180,1152 @@
                         "id": "test",
                         "single_end": true
                     },
-                    "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
+                    "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a"
                 ]
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-03-18T16:18:43.526412"
-    },
-    "versions_paired_end": {
-        "content": [
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:55:42.333545689"
+        "timestamp": "2024-07-05T13:44:27.380974"
     },
-    "test_fastp_paired_end_match": {
+    "test_fastp_paired_end_trim_fail": {
         "content": [
             [
                 [
-                    "test_1.fastp.fastq.gz",
-                    "test_2.fastp.fastq.gz"
-                ],
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=false}"
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-01T12:03:06.431833729"
-    },
-    "test_fastp_interleaved-_match": {
-        "content": [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+                        "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+                    ]
+                ]
+            ],
             [
-                "test.fastp.fastq.gz",
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=true}"
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-03-18T16:19:15.111894"
-    },
-    "test_fastp_paired_end_merged_match": {
-        "content": [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+                        "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+                        "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
             [
                 [
-                    "test_1.fastp.fastq.gz",
-                    "test_2.fastp.fastq.gz"
-                ],
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "test.merged.fastq.gz",
-                "{id=test, single_end=false}"
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-01T12:08:44.496251446"
-    },
-    "versions_single_end_stub": {
-        "content": [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
+                ]
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:55:27.354051299"
+        "timestamp": "2024-07-05T13:43:58.749589"
     },
-    "versions_interleaved-stub": {
+    "fastp - stub test_fastp_interleaved": {
         "content": [
-            [
-                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:56:46.535528418"
+        "timestamp": "2024-07-05T13:50:00.270029"
     },
-    "versions_single_end_trim_fail": {
+    "test_fastp_single_end - stub": {
         "content": [
-            [
-                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:59:03.724591407"
+        "timestamp": "2024-07-05T13:49:42.502789"
     },
-    "test_fastp_paired_end-for_stub_match": {
+    "test_fastp_paired_end_merged_adapterlist - stub": {
         "content": [
-            [
-                [
-                    "test_1.fastp.fastq.gz",
-                    "test_2.fastp.fastq.gz"
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
                 ],
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=false}"
-            ]
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-01-17T18:07:15.398827"
+        "timestamp": "2024-07-05T13:54:53.458252"
     },
-    "versions_paired_end-stub": {
+    "test_fastp_paired_end_merged - stub": {
         "content": [
-            [
-                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:56:06.50017282"
+        "timestamp": "2024-07-05T13:50:27.689379"
     },
-    "versions_single_end": {
+    "test_fastp_paired_end_merged": {
         "content": [
             [
-                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
-            ]
-        ],
-        "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
-        },
-        "timestamp": "2024-02-01T11:55:07.67921647"
-    },
-    "versions_paired_end_merged_stub": {
-        "content": [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:59:47.350653154"
+        "timestamp": "2024-07-05T13:44:08.68476"
     },
-    "test_fastp_interleaved-for_stub_match": {
+    "test_fastp_paired_end - stub": {
         "content": [
-            [
-                "test.fastp.fastq.gz",
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=true}"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-01-17T18:08:06.127974"
+        "timestamp": "2024-07-05T13:49:51.679221"
     },
-    "versions_paired_end_trim_fail": {
+    "test_fastp_single_end": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:59:18.140484878"
+        "timestamp": "2024-07-05T13:43:18.834322"
     },
-    "test_fastp_single_end-for_stub_match": {
+    "test_fastp_single_end_trim_fail - stub": {
         "content": [
-            [
-                "test.fastp.fastq.gz",
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=true}"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "reads_fail": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-01-17T18:06:00.244202"
+        "timestamp": "2024-07-05T14:05:36.898142"
     },
-    "test_fastp_single_end-_match": {
+    "test_fastp_paired_end_trim_fail - stub": {
         "content": [
-            [
-                "test.fastp.fastq.gz",
-                "test.fastp.html",
-                "test.fastp.json",
-                "test.fastp.log",
-                "{id=test, single_end=true}"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "reads_fail": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-03-18T16:18:43.580336"
+        "timestamp": "2024-07-05T14:05:49.212847"
     },
-    "versions_paired_end_merged_adapterlist": {
+    "fastp test_fastp_interleaved": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22"
+                ]
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T12:05:37.845370554"
+        "timestamp": "2024-07-05T13:43:38.910832"
     },
-    "versions_paired_end_merged": {
+    "test_fastp_single_end_trim_fail": {
         "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd"
+                ]
+            ],
+            [
+                
+            ],
             [
                 "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-02-01T11:59:32.860543858"
+        "timestamp": "2024-07-05T13:43:48.22378"
     },
-    "test_fastp_single_end_trim_fail_json": {
+    "test_fastp_paired_end_qc_only": {
         "content": [
             [
                 [
                     {
                         "id": "test",
-                        "single_end": true
+                        "single_end": false
                     },
-                    "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
+                    "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df"
                 ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-05T13:44:36.334938"
+    },
+    "test_fastp_paired_end_qc_only - stub": {
+        "content": [
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    
+                ],
+                "5": [
+                    
+                ],
+                "6": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    
+                ],
+                "reads_fail": [
+                    
+                ],
+                "reads_merged": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-01-17T18:08:41.942317"
+        "timestamp": "2024-07-05T14:31:27.096468"
     }
 }
\ No newline at end of file
diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
index 70edae4d..e9d79a07 100644
--- a/modules/nf-core/fastqc/tests/main.nf.test
+++ b/modules/nf-core/fastqc/tests/main.nf.test
@@ -23,17 +23,14 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
-            // looks like this: <div id="header_filename">Mon 2 Oct 2023<br/>test.gz</div>
-            // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
-
-            { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
-            { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
-            { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_single") }
+                { assert process.success },
+                // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
+                // looks like this: <div id="header_filename">Mon 2 Oct 2023<br/>test.gz</div>
+                // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
+                { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+                { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+                { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -54,16 +51,14 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
-            { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
-            { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
-            { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
-            { assert path(process.out.html[0][1][0]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-            { assert path(process.out.html[0][1][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_paired") }
+                { assert process.success },
+                { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
+                { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
+                { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
+                { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
+                { assert path(process.out.html[0][1][0]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert path(process.out.html[0][1][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -83,13 +78,11 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
-            { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
-            { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") }
+                { assert process.success },
+                { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+                { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+                { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -109,13 +102,11 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
-            { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
-            { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_bam") }
+                { assert process.success },
+                { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+                { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+                { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -138,22 +129,20 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
-            { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
-            { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" },
-            { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" },
-            { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
-            { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
-            { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" },
-            { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" },
-            { assert path(process.out.html[0][1][0]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-            { assert path(process.out.html[0][1][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-            { assert path(process.out.html[0][1][2]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-            { assert path(process.out.html[0][1][3]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_multiple") }
+                { assert process.success },
+                { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
+                { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
+                { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" },
+                { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" },
+                { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
+                { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
+                { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" },
+                { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" },
+                { assert path(process.out.html[0][1][0]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert path(process.out.html[0][1][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert path(process.out.html[0][1][2]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert path(process.out.html[0][1][3]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
@@ -173,21 +162,18 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-
-            { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" },
-            { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" },
-            { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
-
-            { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") }
+                { assert process.success },
+                { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" },
+                { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" },
+                { assert path(process.out.html[0][1]).text.contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+                { assert snapshot(process.out.versions).match() }
             )
         }
     }
 
     test("sarscov2 single-end [fastq] - stub") {
 
-        options "-stub"
-
+    options "-stub"
         when {
             process {
                 """
@@ -201,12 +187,123 @@ nextflow_process {
 
         then {
             assertAll (
-            { assert process.success },
-            { assert snapshot(process.out.html.collect { file(it[1]).getName() } +
-                                process.out.zip.collect { file(it[1]).getName() } +
-                                process.out.versions ).match("fastqc_stub") }
+                { assert process.success },
+                { assert snapshot(process.out).match() }
             )
         }
     }
 
+    test("sarscov2 paired-end [fastq] - stub") {
+
+    options "-stub"
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [id: 'test', single_end: false], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+                ])
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("sarscov2 interleaved [fastq] - stub") {
+
+    options "-stub"
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [id: 'test', single_end: false], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true)
+                ])
+            """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("sarscov2 paired-end [bam] - stub") {
+
+    options "-stub"
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [id: 'test', single_end: false], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+                ])
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("sarscov2 multiple [fastq] - stub") {
+
+    options "-stub"
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [id: 'test', single_end: false], // meta map
+                    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ]
+                ])
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("sarscov2 custom_prefix - stub") {
+
+    options "-stub"
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    [ id:'mysample', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ])
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
 }
diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap
index 86f7c311..d5db3092 100644
--- a/modules/nf-core/fastqc/tests/main.nf.test.snap
+++ b/modules/nf-core/fastqc/tests/main.nf.test.snap
@@ -1,88 +1,392 @@
 {
-    "fastqc_versions_interleaved": {
+    "sarscov2 custom_prefix": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:40:07.293713"
+        "timestamp": "2024-07-22T11:02:16.374038"
     },
-    "fastqc_stub": {
+    "sarscov2 single-end [fastq] - stub": {
         "content": [
-            [
-                "test.html",
-                "test.zip",
-                "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
-            ]
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:02:24.993809"
+    },
+    "sarscov2 custom_prefix - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "mysample",
+                            "single_end": true
+                        },
+                        "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "mysample",
+                            "single_end": true
+                        },
+                        "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "mysample",
+                            "single_end": true
+                        },
+                        "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "mysample",
+                            "single_end": true
+                        },
+                        "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:31:01.425198"
+        "timestamp": "2024-07-22T11:03:10.93942"
     },
-    "fastqc_versions_multiple": {
+    "sarscov2 interleaved [fastq]": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:40:55.797907"
+        "timestamp": "2024-07-22T11:01:42.355718"
     },
-    "fastqc_versions_bam": {
+    "sarscov2 paired-end [bam]": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:40:26.795862"
+        "timestamp": "2024-07-22T11:01:53.276274"
     },
-    "fastqc_versions_single": {
+    "sarscov2 multiple [fastq]": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:39:27.043675"
+        "timestamp": "2024-07-22T11:02:05.527626"
     },
-    "fastqc_versions_paired": {
+    "sarscov2 paired-end [fastq]": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:01:31.188871"
+    },
+    "sarscov2 paired-end [fastq] - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:02:34.273566"
+    },
+    "sarscov2 multiple [fastq] - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:39:47.584191"
+        "timestamp": "2024-07-22T11:03:02.304411"
     },
-    "fastqc_versions_custom_prefix": {
+    "sarscov2 single-end [fastq]": {
         "content": [
             [
                 "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
             ]
         ],
         "meta": {
-            "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:01:19.095607"
+    },
+    "sarscov2 interleaved [fastq] - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T11:02:44.640184"
+    },
+    "sarscov2 paired-end [bam] - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+                ],
+                "zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-01-31T17:41:14.576531"
+        "timestamp": "2024-07-22T11:02:53.550742"
     }
 }
\ No newline at end of file
diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml
index 3c723b21..dfc02a7b 100644
--- a/modules/nf-core/gunzip/environment.yml
+++ b/modules/nf-core/gunzip/environment.yml
@@ -4,4 +4,6 @@ channels:
   - bioconda
   - defaults
 dependencies:
-  - bioconda::multiqc=1.21
+  - conda-forge::grep=3.11
+  - conda-forge::sed=4.8
+  - conda-forge::tar=1.34
diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf
index 468a6f28..5e67e3b9 100644
--- a/modules/nf-core/gunzip/main.nf
+++ b/modules/nf-core/gunzip/main.nf
@@ -4,8 +4,8 @@ process GUNZIP {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'nf-core/ubuntu:20.04' }"
+        'https://depot.galaxyproject.org/singularity/ubuntu:22.04' :
+        'nf-core/ubuntu:22.04' }"
 
     input:
     tuple val(meta), path(archive)
@@ -18,8 +18,11 @@ process GUNZIP {
     task.ext.when == null || task.ext.when
 
     script:
-    def args = task.ext.args ?: ''
-    gunzip = archive.toString() - '.gz'
+    def args        = task.ext.args ?: ''
+    def extension   = ( archive.toString() - '.gz' ).tokenize('.')[-1]
+    def name        = archive.toString() - '.gz' - ".$extension"
+    def prefix      = task.ext.prefix ?: name
+    gunzip          = prefix + ".$extension"
     """
     # Not calling gunzip itself because it creates files
     # with the original group ownership rather than the
@@ -37,7 +40,11 @@ process GUNZIP {
     """
 
     stub:
-    gunzip = archive.toString() - '.gz'
+    def args        = task.ext.args ?: ''
+    def extension   = ( archive.toString() - '.gz' ).tokenize('.')[-1]
+    def name        = archive.toString() - '.gz' - ".$extension"
+    def prefix      = task.ext.prefix ?: name
+    gunzip          = prefix + ".$extension"
     """
     touch $gunzip
     cat <<-END_VERSIONS > versions.yml
diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml
index 231034f2..f32973a0 100644
--- a/modules/nf-core/gunzip/meta.yml
+++ b/modules/nf-core/gunzip/meta.yml
@@ -37,3 +37,4 @@ maintainers:
   - "@joseespinosa"
   - "@drpatelh"
   - "@jfy133"
+  - "@gallvp"
diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test
index 6406008e..776211ad 100644
--- a/modules/nf-core/gunzip/tests/main.nf.test
+++ b/modules/nf-core/gunzip/tests/main.nf.test
@@ -33,4 +33,89 @@ nextflow_process {
 
     }
 
+    test("Should run without failures - prefix") {
+
+        config './nextflow.config'
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = Channel.of([
+                        [ id: 'test' ],
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                    ]
+                )
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("Should run without failures - stub") {
+
+        options '-stub'
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = Channel.of([
+                        [],
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                    ]
+                )
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("Should run without failures - prefix - stub") {
+
+        options '-stub'
+        config './nextflow.config'
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = Channel.of([
+                        [ id: 'test' ],
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                    ]
+                )
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
 }
diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap
index 720fd9ff..069967e7 100644
--- a/modules/nf-core/gunzip/tests/main.nf.test.snap
+++ b/modules/nf-core/gunzip/tests/main.nf.test.snap
@@ -1,4 +1,70 @@
 {
+    "Should run without failures - prefix - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ],
+                "gunzip": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-25T11:35:10.861293"
+    },
+    "Should run without failures - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        [
+                            
+                        ],
+                        "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ],
+                "gunzip": [
+                    [
+                        [
+                            
+                        ],
+                        "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-25T11:35:05.857145"
+    },
     "Should run without failures": {
         "content": [
             {
@@ -26,6 +92,43 @@
                 ]
             }
         ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
         "timestamp": "2023-10-17T15:35:37.690477896"
+    },
+    "Should run without failures - prefix": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ],
+                "gunzip": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-25T11:33:32.921739"
     }
 }
\ No newline at end of file
diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config
new file mode 100644
index 00000000..dec77642
--- /dev/null
+++ b/modules/nf-core/gunzip/tests/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    withName: GUNZIP {
+        ext.prefix = { "${meta.id}.xyz" }
+    }
+}
diff --git a/modules/pfr/merqury/hapmers/environment.yml b/modules/nf-core/merqury/hapmers/environment.yml
similarity index 100%
rename from modules/pfr/merqury/hapmers/environment.yml
rename to modules/nf-core/merqury/hapmers/environment.yml
diff --git a/modules/pfr/merqury/hapmers/main.nf b/modules/nf-core/merqury/hapmers/main.nf
similarity index 100%
rename from modules/pfr/merqury/hapmers/main.nf
rename to modules/nf-core/merqury/hapmers/main.nf
diff --git a/modules/pfr/merqury/hapmers/meta.yml b/modules/nf-core/merqury/hapmers/meta.yml
similarity index 100%
rename from modules/pfr/merqury/hapmers/meta.yml
rename to modules/nf-core/merqury/hapmers/meta.yml
diff --git a/modules/pfr/merqury/hapmers/tests/main.nf.test b/modules/nf-core/merqury/hapmers/tests/main.nf.test
similarity index 100%
rename from modules/pfr/merqury/hapmers/tests/main.nf.test
rename to modules/nf-core/merqury/hapmers/tests/main.nf.test
diff --git a/modules/pfr/merqury/hapmers/tests/main.nf.test.snap b/modules/nf-core/merqury/hapmers/tests/main.nf.test.snap
similarity index 100%
rename from modules/pfr/merqury/hapmers/tests/main.nf.test.snap
rename to modules/nf-core/merqury/hapmers/tests/main.nf.test.snap
diff --git a/modules/nf-core/merqury/hapmers/tests/tags.yml b/modules/nf-core/merqury/hapmers/tests/tags.yml
new file mode 100644
index 00000000..473bd269
--- /dev/null
+++ b/modules/nf-core/merqury/hapmers/tests/tags.yml
@@ -0,0 +1,2 @@
+merqury/hapmers:
+  - "modules/nf-core/merqury/hapmers/**"
diff --git a/modules/nf-core/meryl/count/main.nf b/modules/nf-core/meryl/count/main.nf
index 0f1ff0af..c1540cc8 100644
--- a/modules/nf-core/meryl/count/main.nf
+++ b/modules/nf-core/meryl/count/main.nf
@@ -1,6 +1,6 @@
 process MERYL_COUNT {
     tag "$meta.id"
-    label 'process_medium'
+    label 'process_high'
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
diff --git a/modules/nf-core/minimap2/align/environment.yml b/modules/nf-core/minimap2/align/environment.yml
index 051ca8ef..41e8fe9f 100644
--- a/modules/nf-core/minimap2/align/environment.yml
+++ b/modules/nf-core/minimap2/align/environment.yml
@@ -1,9 +1,11 @@
 name: minimap2_align
+
 channels:
   - conda-forge
   - bioconda
   - defaults
+
 dependencies:
+  - bioconda::htslib=1.20
   - bioconda::minimap2=2.28
-  - bioconda::samtools=1.19.2
-  - bioconda::htslib=1.19.1
+  - bioconda::samtools=1.20
diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf
index 62349edc..d82dc14d 100644
--- a/modules/nf-core/minimap2/align/main.nf
+++ b/modules/nf-core/minimap2/align/main.nf
@@ -5,21 +5,22 @@ process MINIMAP2_ALIGN {
     // Note: the versions here need to match the versions used in the mulled container below and minimap2/index
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3a70f8bc7e17b723591f6132418640cfdbc88246-0' :
-        'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3a70f8bc7e17b723591f6132418640cfdbc88246-0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' :
+        'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' }"
 
     input:
     tuple val(meta), path(reads)
     tuple val(meta2), path(reference)
     val bam_format
+    val bam_index_extension
     val cigar_paf_format
     val cigar_bam
 
     output:
-    tuple val(meta), path("*.paf"), optional: true, emit: paf
-    tuple val(meta), path("*.bam"), optional: true, emit: bam
-    tuple val(meta), path("*.csi"), optional: true, emit: csi
-    path "versions.yml"           , emit: versions
+    tuple val(meta), path("*.paf")                       , optional: true, emit: paf
+    tuple val(meta), path("*.bam")                       , optional: true, emit: bam
+    tuple val(meta), path("*.bam.${bam_index_extension}"), optional: true, emit: index
+    path "versions.yml"                                  , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -27,16 +28,25 @@ process MINIMAP2_ALIGN {
     script:
     def args  = task.ext.args ?: ''
     def args2 = task.ext.args2 ?: ''
+    def args3 = task.ext.args3 ?: ''
+    def args4 = task.ext.args4 ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
-    def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus-1} -o ${prefix}.bam ${args2}" : "-o ${prefix}.paf"
+    def bam_index = bam_index_extension ? "${prefix}.bam##idx##${prefix}.bam.${bam_index_extension} --write-index" : "${prefix}.bam"
+    def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus-1} -o ${bam_index} ${args2}" : "-o ${prefix}.paf"
     def cigar_paf = cigar_paf_format && !bam_format ? "-c" : ''
     def set_cigar_bam = cigar_bam && bam_format ? "-L" : ''
+    def bam_input = "${reads.extension}".matches('sam|bam|cram')
+    def samtools_reset_fastq = bam_input ? "samtools reset --threads ${task.cpus-1} $args3 $reads | samtools fastq --threads ${task.cpus-1} $args4 |" : ''
+    def query = bam_input ? "-" : reads
+    def target = reference ?: (bam_input ? error("BAM input requires reference") : reads)
+
     """
+    $samtools_reset_fastq \\
     minimap2 \\
         $args \\
         -t $task.cpus \\
-        ${reference ?: reads} \\
-        $reads \\
+        $target \\
+        $query \\
         $cigar_paf \\
         $set_cigar_bam \\
         $bam_output
@@ -45,15 +55,20 @@ process MINIMAP2_ALIGN {
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         minimap2: \$(minimap2 --version 2>&1)
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
     END_VERSIONS
     """
 
     stub:
     def prefix = task.ext.prefix ?: "${meta.id}"
     def output_file = bam_format ? "${prefix}.bam" : "${prefix}.paf"
+    def bam_index = bam_index_extension ? "touch ${prefix}.bam.${bam_index_extension}" : ""
+    def bam_input = "${reads.extension}".matches('sam|bam|cram')
+    def target = reference ?: (bam_input ? error("BAM input requires reference") : reads)
+
     """
     touch $output_file
-    touch ${prefix}.csi
+    ${bam_index}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml
index 408522d5..8996f881 100644
--- a/modules/nf-core/minimap2/align/meta.yml
+++ b/modules/nf-core/minimap2/align/meta.yml
@@ -37,6 +37,9 @@ input:
   - bam_format:
       type: boolean
       description: Specify that output should be in BAM format
+  - bam_index_extension:
+      type: string
+      description: BAM alignment index extension (e.g. "bai")
   - cigar_paf_format:
       type: boolean
       description: Specify that output CIGAR should be in PAF format
@@ -59,6 +62,10 @@ output:
       type: file
       description: Alignment in BAM format
       pattern: "*.bam"
+  - index:
+      type: file
+      description: BAM alignment index
+      pattern: "*.bam.*"
   - versions:
       type: file
       description: File containing software versions
@@ -68,8 +75,10 @@ authors:
   - "@sofstam"
   - "@sateeshperi"
   - "@jfy133"
+  - "@fellen31"
 maintainers:
   - "@heuermh"
   - "@sofstam"
   - "@sateeshperi"
   - "@jfy133"
+  - "@fellen31"
diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test
index 83cceeab..4072c171 100644
--- a/modules/nf-core/minimap2/align/tests/main.nf.test
+++ b/modules/nf-core/minimap2/align/tests/main.nf.test
@@ -9,22 +9,23 @@ nextflow_process {
     tag "minimap2"
     tag "minimap2/align"
 
-    test("sarscov2 - fastq, fasta, true, false, false") {
+    test("sarscov2 - fastq, fasta, true, [], false, false") {
 
         when {
             process {
                 """
                 input[0] = [
                     [ id:'test', single_end:true ], // meta map
-                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
                 ]
                 input[1] = [
                     [ id:'test_ref' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[2] = true
-                input[3] = false
+                input[3] = []
                 input[4] = false
+                input[5] = false
                 """
             }
         }
@@ -33,7 +34,43 @@ nextflow_process {
             assertAll(
                 { assert process.success },
                 { assert snapshot(
-                    file(process.out.bam[0][1]).name,
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, fasta, true, 'bai', false, false") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = 'bai'
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
+                    file(process.out.index[0][1]).name,
                     process.out.versions
                 ).match() }
             )
@@ -49,17 +86,18 @@ nextflow_process {
                 input[0] = [
                     [ id:'test', single_end:false ], // meta map
                     [
-                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
                     ]
                 ]
                 input[1] = [
                     [ id:'test_ref' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[2] = true
-                input[3] = false
+                input[3] = []
                 input[4] = false
+                input[5] = false
                 """
             }
         }
@@ -68,7 +106,8 @@ nextflow_process {
             assertAll(
                 { assert process.success },
                 { assert snapshot(
-                    file(process.out.bam[0][1]).name,
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
                     process.out.versions
                 ).match() }
             )
@@ -83,15 +122,16 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:true ], // meta map
-                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
                 ]
                 input[1] = [
                     [ id:'test_ref' ], // meta map
                     []
                 ]
                 input[2] = true
-                input[3] = false
+                input[3] = []
                 input[4] = false
+                input[5] = false
                 """
             }
         }
@@ -100,7 +140,8 @@ nextflow_process {
             assertAll(
                 { assert process.success },
                 { assert snapshot(
-                    file(process.out.bam[0][1]).name,
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
                     process.out.versions
                 ).match() }
             )
@@ -108,24 +149,57 @@ nextflow_process {
 
     }
 
-    test("sarscov2 - fastq, fasta, true, false, false - stub") {
+    test("sarscov2 - bam, fasta, true, [], false, false") {
 
-        options "-stub"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = []
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - bam, fasta, true, 'bai', false, false") {
 
         when {
             process {
                 """
                 input[0] = [
                     [ id:'test', single_end:true ], // meta map
-                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
                 ]
                 input[1] = [
                     [ id:'test_ref' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[2] = true
-                input[3] = false
+                input[3] = 'bai'
                 input[4] = false
+                input[5] = false
                 """
             }
         }
@@ -134,8 +208,9 @@ nextflow_process {
             assertAll(
                 { assert process.success },
                 { assert snapshot(
-                    file(process.out.bam[0][1]).name,
-                    file(process.out.csi[0][1]).name,
+                    bam(process.out.bam[0][1]).getHeader(),
+                    bam(process.out.bam[0][1]).getReadsMD5(),
+                    file(process.out.index[0][1]).name,
                     process.out.versions
                 ).match() }
             )
@@ -143,7 +218,36 @@ nextflow_process {
 
     }
 
-    test("sarscov2 - fastq, fasta, false, false, false - stub") {
+    test("sarscov2 - bam, [], true, false, false") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    []
+                ]
+                input[2] = true
+                input[3] = []
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.failed }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, fasta, true, [], false, false - stub") {
 
         options "-stub"
 
@@ -152,15 +256,80 @@ nextflow_process {
                 """
                 input[0] = [
                     [ id:'test', single_end:true ], // meta map
-                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
                 ]
                 input[1] = [
                     [ id:'test_ref' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = []
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, fasta, true, 'bai', false, false - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = 'bai'
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, fasta, false, [], false, false - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ]
                 input[2] = false
-                input[3] = false
+                input[3] = []
                 input[4] = false
+                input[5] = false
                 """
             }
         }
@@ -168,11 +337,102 @@ nextflow_process {
         then {
             assertAll(
                 { assert process.success },
-                { assert snapshot(
-                    file(process.out.paf[0][1]).name,
-                    file(process.out.csi[0][1]).name,
-                    process.out.versions
-                ).match() }
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - bam, fasta, true, [], false, false - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = []
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - bam, fasta, true, 'bai', false, false - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                input[2] = true
+                input[3] = 'bai'
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - bam, [], true, false, false - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test_ref' ], // meta map
+                    []
+                ]
+                input[2] = true
+                input[3] = []
+                input[4] = false
+                input[5] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.failed }
             )
         }
 
diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap
index 19a8f204..12264a85 100644
--- a/modules/nf-core/minimap2/align/tests/main.nf.test.snap
+++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap
@@ -1,69 +1,476 @@
 {
-    "sarscov2 - fastq, fasta, true, false, false": {
+    "sarscov2 - bam, fasta, true, 'bai', false, false": {
         "content": [
-            "test.bam",
             [
-                "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:MT192765.1\tLN:29829",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index"
+            ],
+            "5d426b9a5f5b2c54f1d7f1e4c238ae94",
+            "test.bam.bai",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-25T09:03:00.827260362"
+    },
+    "sarscov2 - bam, fasta, true, 'bai', false, false - stub": {
+        "content": [
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ],
+                "bam": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "index": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "paf": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-23T11:21:37.92353539"
+    },
+    "sarscov2 - fastq, fasta, true, 'bai', false, false - stub": {
+        "content": [
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ],
+                "bam": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "index": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "paf": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-03T11:29:44.669021368"
+    },
+    "sarscov2 - fastq, fasta, false, [], false, false - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ],
+                "bam": [
+                    
+                ],
+                "index": [
+                    
+                ],
+                "paf": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-03T11:15:52.738781039"
+    },
+    "sarscov2 - fastq, fasta, true, [], false, false - stub": {
+        "content": [
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ],
+                "bam": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "index": [
+                    
+                ],
+                "paf": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-03T11:15:23.033808223"
+    },
+    "sarscov2 - [fastq1, fastq2], fasta, true, false, false": {
+        "content": [
+            [
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:MT192765.1\tLN:29829",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz test_2.fastq.gz",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam"
+            ],
+            "1bc392244f228bf52cf0b5a8f6a654c9",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-04-05T10:14:18.939731126"
+        "timestamp": "2024-07-23T11:18:18.964586894"
     },
-    "sarscov2 - fastq, fasta, true, false, false - stub": {
+    "sarscov2 - fastq, fasta, true, [], false, false": {
         "content": [
-            "test.bam",
-            "test.csi",
             [
-                "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:MT192765.1\tLN:29829",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam"
+            ],
+            "f194745c0ccfcb2a9c0aee094a08750",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-04-05T10:14:34.275879844"
+        "timestamp": "2024-07-23T11:17:48.667488325"
     },
-    "sarscov2 - fastq, fasta, false, false, false - stub": {
+    "sarscov2 - fastq, fasta, true, 'bai', false, false": {
         "content": [
-            "test.paf",
-            "test.csi",
             [
-                "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:MT192765.1\tLN:29829",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index"
+            ],
+            "f194745c0ccfcb2a9c0aee094a08750",
+            "test.bam.bai",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-04-05T10:14:39.227958138"
+        "timestamp": "2024-07-23T11:18:02.517416733"
     },
-    "sarscov2 - [fastq1, fastq2], fasta, true, false, false": {
+    "sarscov2 - bam, fasta, true, [], false, false": {
         "content": [
-            "test.bam",
             [
-                "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:MT192765.1\tLN:29829",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam"
+            ],
+            "5d426b9a5f5b2c54f1d7f1e4c238ae94",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-04-05T10:14:24.265054877"
+        "timestamp": "2024-07-25T09:02:49.64829488"
+    },
+    "sarscov2 - bam, fasta, true, [], false, false - stub": {
+        "content": [
+            {
+                "0": [
+                    
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ],
+                "bam": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "index": [
+                    
+                ],
+                "paf": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-23T11:21:22.162291795"
     },
     "sarscov2 - fastq, [], true, false, false": {
         "content": [
-            "test.bam",
             [
-                "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938"
+                "@HD\tVN:1.6\tSO:coordinate",
+                "@SQ\tSN:ERR5069949.2151832\tLN:150",
+                "@SQ\tSN:ERR5069949.576388\tLN:77",
+                "@SQ\tSN:ERR5069949.501486\tLN:146",
+                "@SQ\tSN:ERR5069949.1331889\tLN:132",
+                "@SQ\tSN:ERR5069949.2161340\tLN:80",
+                "@SQ\tSN:ERR5069949.973930\tLN:79",
+                "@SQ\tSN:ERR5069949.2417063\tLN:150",
+                "@SQ\tSN:ERR5069949.376959\tLN:151",
+                "@SQ\tSN:ERR5069949.1088785\tLN:149",
+                "@SQ\tSN:ERR5069949.1066259\tLN:147",
+                "@SQ\tSN:ERR5069949.2832676\tLN:139",
+                "@SQ\tSN:ERR5069949.2953930\tLN:151",
+                "@SQ\tSN:ERR5069949.324865\tLN:151",
+                "@SQ\tSN:ERR5069949.2185111\tLN:150",
+                "@SQ\tSN:ERR5069949.937422\tLN:151",
+                "@SQ\tSN:ERR5069949.2431709\tLN:150",
+                "@SQ\tSN:ERR5069949.1246538\tLN:148",
+                "@SQ\tSN:ERR5069949.1189252\tLN:98",
+                "@SQ\tSN:ERR5069949.2216307\tLN:147",
+                "@SQ\tSN:ERR5069949.3273002\tLN:148",
+                "@SQ\tSN:ERR5069949.3277445\tLN:151",
+                "@SQ\tSN:ERR5069949.3022231\tLN:147",
+                "@SQ\tSN:ERR5069949.184542\tLN:151",
+                "@SQ\tSN:ERR5069949.540529\tLN:149",
+                "@SQ\tSN:ERR5069949.686090\tLN:150",
+                "@SQ\tSN:ERR5069949.2787556\tLN:106",
+                "@SQ\tSN:ERR5069949.2650879\tLN:150",
+                "@SQ\tSN:ERR5069949.2064910\tLN:149",
+                "@SQ\tSN:ERR5069949.2328704\tLN:150",
+                "@SQ\tSN:ERR5069949.1067032\tLN:150",
+                "@SQ\tSN:ERR5069949.3338256\tLN:151",
+                "@SQ\tSN:ERR5069949.1412839\tLN:147",
+                "@SQ\tSN:ERR5069949.1538968\tLN:150",
+                "@SQ\tSN:ERR5069949.147998\tLN:94",
+                "@SQ\tSN:ERR5069949.366975\tLN:106",
+                "@SQ\tSN:ERR5069949.1372331\tLN:151",
+                "@SQ\tSN:ERR5069949.1709367\tLN:129",
+                "@SQ\tSN:ERR5069949.2388984\tLN:150",
+                "@SQ\tSN:ERR5069949.1132353\tLN:150",
+                "@SQ\tSN:ERR5069949.1151736\tLN:151",
+                "@SQ\tSN:ERR5069949.479807\tLN:150",
+                "@SQ\tSN:ERR5069949.2176303\tLN:151",
+                "@SQ\tSN:ERR5069949.2772897\tLN:151",
+                "@SQ\tSN:ERR5069949.1020777\tLN:122",
+                "@SQ\tSN:ERR5069949.465452\tLN:151",
+                "@SQ\tSN:ERR5069949.1704586\tLN:149",
+                "@SQ\tSN:ERR5069949.1258508\tLN:151",
+                "@SQ\tSN:ERR5069949.986441\tLN:119",
+                "@SQ\tSN:ERR5069949.2674295\tLN:148",
+                "@SQ\tSN:ERR5069949.885966\tLN:79",
+                "@SQ\tSN:ERR5069949.2342766\tLN:151",
+                "@SQ\tSN:ERR5069949.3122970\tLN:127",
+                "@SQ\tSN:ERR5069949.3279513\tLN:72",
+                "@SQ\tSN:ERR5069949.309410\tLN:151",
+                "@SQ\tSN:ERR5069949.532979\tLN:149",
+                "@SQ\tSN:ERR5069949.2888794\tLN:151",
+                "@SQ\tSN:ERR5069949.2205229\tLN:150",
+                "@SQ\tSN:ERR5069949.786562\tLN:151",
+                "@SQ\tSN:ERR5069949.919671\tLN:151",
+                "@SQ\tSN:ERR5069949.1328186\tLN:151",
+                "@SQ\tSN:ERR5069949.870926\tLN:149",
+                "@SQ\tSN:ERR5069949.2257580\tLN:151",
+                "@SQ\tSN:ERR5069949.3249622\tLN:77",
+                "@SQ\tSN:ERR5069949.611123\tLN:125",
+                "@SQ\tSN:ERR5069949.651338\tLN:142",
+                "@SQ\tSN:ERR5069949.169513\tLN:92",
+                "@SQ\tSN:ERR5069949.155944\tLN:150",
+                "@SQ\tSN:ERR5069949.2033605\tLN:150",
+                "@SQ\tSN:ERR5069949.2730382\tLN:142",
+                "@SQ\tSN:ERR5069949.2125592\tLN:150",
+                "@SQ\tSN:ERR5069949.1062611\tLN:151",
+                "@SQ\tSN:ERR5069949.1778133\tLN:151",
+                "@SQ\tSN:ERR5069949.3057020\tLN:95",
+                "@SQ\tSN:ERR5069949.2972968\tLN:141",
+                "@SQ\tSN:ERR5069949.2734474\tLN:149",
+                "@SQ\tSN:ERR5069949.856527\tLN:151",
+                "@SQ\tSN:ERR5069949.2098070\tLN:151",
+                "@SQ\tSN:ERR5069949.1552198\tLN:150",
+                "@SQ\tSN:ERR5069949.2385514\tLN:150",
+                "@SQ\tSN:ERR5069949.2270078\tLN:151",
+                "@SQ\tSN:ERR5069949.114870\tLN:150",
+                "@SQ\tSN:ERR5069949.2668880\tLN:147",
+                "@SQ\tSN:ERR5069949.257821\tLN:139",
+                "@SQ\tSN:ERR5069949.2243023\tLN:150",
+                "@SQ\tSN:ERR5069949.2605155\tLN:146",
+                "@SQ\tSN:ERR5069949.1340552\tLN:151",
+                "@SQ\tSN:ERR5069949.1561137\tLN:150",
+                "@SQ\tSN:ERR5069949.2361683\tLN:149",
+                "@SQ\tSN:ERR5069949.2521353\tLN:150",
+                "@SQ\tSN:ERR5069949.1261808\tLN:149",
+                "@SQ\tSN:ERR5069949.2734873\tLN:98",
+                "@SQ\tSN:ERR5069949.3017828\tLN:107",
+                "@SQ\tSN:ERR5069949.573706\tLN:150",
+                "@SQ\tSN:ERR5069949.1980512\tLN:151",
+                "@SQ\tSN:ERR5069949.1014693\tLN:150",
+                "@SQ\tSN:ERR5069949.3184655\tLN:150",
+                "@SQ\tSN:ERR5069949.29668\tLN:89",
+                "@SQ\tSN:ERR5069949.3258358\tLN:151",
+                "@SQ\tSN:ERR5069949.1476386\tLN:151",
+                "@SQ\tSN:ERR5069949.2415814\tLN:150",
+                "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a test_1.fastq.gz test_1.fastq.gz",
+                "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam"
+            ],
+            "16c1c651f8ec67383bcdee3c55aed94f",
+            [
+                "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-04-05T10:14:29.27901773"
+        "timestamp": "2024-07-23T11:18:34.246998277"
     }
 }
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/environment.yml b/modules/nf-core/umitools/extract/environment.yml
new file mode 100644
index 00000000..aab452d1
--- /dev/null
+++ b/modules/nf-core/umitools/extract/environment.yml
@@ -0,0 +1,7 @@
+name: umitools_extract
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::umi_tools=1.1.5
diff --git a/modules/nf-core/umitools/extract/main.nf b/modules/nf-core/umitools/extract/main.nf
new file mode 100644
index 00000000..b97900e0
--- /dev/null
+++ b/modules/nf-core/umitools/extract/main.nf
@@ -0,0 +1,74 @@
+process UMITOOLS_EXTRACT {
+    tag "$meta.id"
+    label "process_single"
+    label "process_long"
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/umi_tools:1.1.5--py39hf95cd2a_0' :
+        'biocontainers/umi_tools:1.1.5--py39hf95cd2a_0' }"
+
+    input:
+    tuple val(meta), path(reads)
+
+    output:
+    tuple val(meta), path("*.fastq.gz"), emit: reads
+    tuple val(meta), path("*.log")     , emit: log
+    path  "versions.yml"               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    if (meta.single_end) {
+        """
+        umi_tools \\
+            extract \\
+            -I $reads \\
+            -S ${prefix}.umi_extract.fastq.gz \\
+            $args \\
+            > ${prefix}.umi_extract.log
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+        END_VERSIONS
+        """
+    }  else {
+        """
+        umi_tools \\
+            extract \\
+            -I ${reads[0]} \\
+            --read2-in=${reads[1]} \\
+            -S ${prefix}.umi_extract_1.fastq.gz \\
+            --read2-out=${prefix}.umi_extract_2.fastq.gz \\
+            $args \\
+            > ${prefix}.umi_extract.log
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+        END_VERSIONS
+        """
+    }
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    if (meta.single_end) {
+        output_command = "echo '' | gzip > ${prefix}.umi_extract.fastq.gz"
+    } else {
+        output_command = "echo '' | gzip > ${prefix}.umi_extract_1.fastq.gz ;"
+        output_command += "echo '' | gzip > ${prefix}.umi_extract_2.fastq.gz"
+    }
+    """
+    touch ${prefix}.umi_extract.log
+    ${output_command}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        umitools: \$( umi_tools --version | sed '/version:/!d; s/.*: //' )
+    END_VERSIONS
+    """
+}
diff --git a/modules/nf-core/umitools/extract/meta.yml b/modules/nf-core/umitools/extract/meta.yml
new file mode 100644
index 00000000..7695b271
--- /dev/null
+++ b/modules/nf-core/umitools/extract/meta.yml
@@ -0,0 +1,48 @@
+name: umitools_extract
+description: Extracts UMI barcode from a read and add it to the read name, leaving any sample barcode in place
+keywords:
+  - UMI
+  - barcode
+  - extract
+  - umitools
+tools:
+  - umi_tools:
+      description: >
+        UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs) and single cell RNA-Seq cell barcodes
+      documentation: https://umi-tools.readthedocs.io/en/latest/
+      license: "MIT"
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: list
+      description: |
+        List of input FASTQ files whose UMIs will be extracted.
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: >
+        Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. | For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
+      pattern: "*.{fastq.gz}"
+  - log:
+      type: file
+      description: Logfile for umi_tools
+      pattern: "*.{log}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@drpatelh"
+  - "@grst"
+maintainers:
+  - "@drpatelh"
+  - "@grst"
diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test b/modules/nf-core/umitools/extract/tests/main.nf.test
new file mode 100644
index 00000000..bb8a0658
--- /dev/null
+++ b/modules/nf-core/umitools/extract/tests/main.nf.test
@@ -0,0 +1,106 @@
+nextflow_process {
+
+    name "Test Process UMITOOLS_EXTRACT"
+    script "../main.nf"
+    process "UMITOOLS_EXTRACT"
+    config "./nextflow.config"
+    tag "modules_nfcore"
+    tag "modules"
+    tag "umitools"
+    tag "umitools/extract"
+
+    test("single end") {
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                    [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    process.out.reads.collect { it.collect { it instanceof Map ? it : file(it).name }},
+                    process.out.log.collect { it.collect { it instanceof Map ? it : file(it).name }},
+                    process.out.versions
+                ).match() }
+            )
+        }
+    }
+
+    test("single end - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                    [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+    test("pair end") {
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
+                    file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.reads[0][1][0]).name,
+                    file(process.out.reads[0][1][1]).name,
+                    process.out.log.collect { it.collect { it instanceof Map ? it : file(it).name }},
+                    process.out.versions
+                ).match() }
+            )
+        }
+    }
+
+    test("pair end - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                    [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
+                    file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/tests/main.nf.test.snap b/modules/nf-core/umitools/extract/tests/main.nf.test.snap
new file mode 100644
index 00000000..b1159054
--- /dev/null
+++ b/modules/nf-core/umitools/extract/tests/main.nf.test.snap
@@ -0,0 +1,167 @@
+{
+    "pair end - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.umi_extract_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test.umi_extract_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.umi_extract_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test.umi_extract_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-02T15:05:20.008312"
+    },
+    "single end - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.umi_extract.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+                ],
+                "log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.umi_extract.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-02T15:04:12.145999"
+    },
+    "pair end": {
+        "content": [
+            "test.umi_extract_1.fastq.gz",
+            "test.umi_extract_2.fastq.gz",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.umi_extract.log"
+                ]
+            ],
+            [
+                "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-02T15:21:09.578031"
+    },
+    "single end": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.umi_extract.fastq.gz"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.umi_extract.log"
+                ]
+            ],
+            [
+                "versions.yml:md5,568d243174c081a0301e74ed42e59b48"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-07-02T15:03:52.464606"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/umitools/extract/tests/nextflow.config b/modules/nf-core/umitools/extract/tests/nextflow.config
new file mode 100644
index 00000000..c866f5a0
--- /dev/null
+++ b/modules/nf-core/umitools/extract/tests/nextflow.config
@@ -0,0 +1,9 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+    withName: UMITOOLS_EXTRACT {
+        ext.args = '--bc-pattern="NNNN"'
+    }
+
+}
diff --git a/modules/nf-core/umitools/extract/tests/tags.yml b/modules/nf-core/umitools/extract/tests/tags.yml
new file mode 100644
index 00000000..c3fb23de
--- /dev/null
+++ b/modules/nf-core/umitools/extract/tests/tags.yml
@@ -0,0 +1,2 @@
+umitools/extract:
+  - modules/nf-core/umitools/extract/**
diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml
index 0c9cbb10..4f498244 100644
--- a/modules/nf-core/untar/environment.yml
+++ b/modules/nf-core/untar/environment.yml
@@ -1,11 +1,9 @@
 name: untar
-
 channels:
   - conda-forge
   - bioconda
   - defaults
-
 dependencies:
   - conda-forge::grep=3.11
-  - conda-forge::sed=4.7
+  - conda-forge::sed=4.8
   - conda-forge::tar=1.34
diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf
index 8a75bb95..9bd8f554 100644
--- a/modules/nf-core/untar/main.nf
+++ b/modules/nf-core/untar/main.nf
@@ -4,8 +4,8 @@ process UNTAR {
 
     conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'nf-core/ubuntu:20.04' }"
+        'https://depot.galaxyproject.org/singularity/ubuntu:22.04' :
+        'nf-core/ubuntu:22.04' }"
 
     input:
     tuple val(meta), path(archive)
@@ -52,8 +52,29 @@ process UNTAR {
     stub:
     prefix    = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, ""))
     """
-    mkdir $prefix
-    touch ${prefix}/file.txt
+    mkdir ${prefix}
+    ## Dry-run untaring the archive to get the files and place all in prefix
+    if [[ \$(tar -taf ${archive} | grep -o -P "^.*?\\/" | uniq | wc -l) -eq 1 ]]; then
+        for i in `tar -tf ${archive}`;
+        do
+            if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]];
+            then
+                touch \${i}
+            else
+                mkdir -p \${i}
+            fi
+        done
+    else
+        for i in `tar -tf ${archive}`;
+        do
+            if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]];
+            then
+                touch ${prefix}/\${i}
+            else
+                mkdir -p ${prefix}/\${i}
+            fi
+        done
+    fi
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test
index 2a7c97bf..c957517a 100644
--- a/modules/nf-core/untar/tests/main.nf.test
+++ b/modules/nf-core/untar/tests/main.nf.test
@@ -6,6 +6,7 @@ nextflow_process {
     tag "modules"
     tag "modules_nfcore"
     tag "untar"
+
     test("test_untar") {
 
         when {
@@ -19,10 +20,9 @@ nextflow_process {
         then {
             assertAll (
                 { assert process.success },
-                { assert snapshot(process.out.untar).match("test_untar") },
+                { assert snapshot(process.out).match() },
             )
         }
-
     }
 
     test("test_untar_onlyfiles") {
@@ -38,10 +38,48 @@ nextflow_process {
         then {
             assertAll (
                 { assert process.success },
-                { assert snapshot(process.out.untar).match("test_untar_onlyfiles") },
+                { assert snapshot(process.out).match() },
             )
         }
+    }
+
+    test("test_untar - stub") {
+
+        options "-stub"
 
+        when {
+            process {
+                """
+                input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
     }
 
+    test("test_untar_onlyfiles - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() },
+            )
+        }
+    }
 }
diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap
index 64550292..ceb91b79 100644
--- a/modules/nf-core/untar/tests/main.nf.test.snap
+++ b/modules/nf-core/untar/tests/main.nf.test.snap
@@ -1,42 +1,158 @@
 {
     "test_untar_onlyfiles": {
         "content": [
-            [
-                [
+            {
+                "0": [
                     [
-                        
-                    ],
+                        [
+                            
+                        ],
+                        [
+                            "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ],
+                "untar": [
+                    [
+                        [
+                            
+                        ],
+                        [
+                            "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+                        ]
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-10T12:04:28.231047"
+    },
+    "test_untar_onlyfiles - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        [
+                            
+                        ],
+                        [
+                            "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ],
+                "untar": [
                     [
-                        "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+                        [
+                            
+                        ],
+                        [
+                            "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
                     ]
+                ],
+                "versions": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
                 ]
-            ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-28T11:49:41.320643"
+        "timestamp": "2024-07-10T12:04:45.773103"
+    },
+    "test_untar - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        [
+                            
+                        ],
+                        [
+                            "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ],
+                "untar": [
+                    [
+                        [
+                            
+                        ],
+                        [
+                            "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-10T12:04:36.777441"
     },
     "test_untar": {
         "content": [
-            [
-                [
+            {
+                "0": [
                     [
-                        
-                    ],
+                        [
+                            
+                        ],
+                        [
+                            "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
+                            "opts.k2d:md5,a033d00cf6759407010b21700938f543",
+                            "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+                ],
+                "untar": [
                     [
-                        "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
-                        "opts.k2d:md5,a033d00cf6759407010b21700938f543",
-                        "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+                        [
+                            
+                        ],
+                        [
+                            "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
+                            "opts.k2d:md5,a033d00cf6759407010b21700938f543",
+                            "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+                        ]
                     ]
+                ],
+                "versions": [
+                    "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
                 ]
-            ]
+            }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-02-28T11:49:33.795172"
+        "timestamp": "2024-07-10T12:04:19.377674"
     }
 }
\ No newline at end of file
diff --git a/modules/pfr/custom/relabelfasta/tests/tags.yml b/modules/pfr/custom/relabelfasta/tests/tags.yml
deleted file mode 100644
index 2db1f658..00000000
--- a/modules/pfr/custom/relabelfasta/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-custom/relabelfasta:
-  - "modules/pfr/custom/relabelfasta/**"
diff --git a/modules/pfr/custom/restoregffids/tests/tags.yml b/modules/pfr/custom/restoregffids/tests/tags.yml
deleted file mode 100644
index 1d4b9a83..00000000
--- a/modules/pfr/custom/restoregffids/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-custom/restoregffids:
-  - "modules/pfr/custom/restoregffids/**"
diff --git a/modules/pfr/custom/shortenfastaids/tests/tags.yml b/modules/pfr/custom/shortenfastaids/tests/tags.yml
deleted file mode 100644
index 4715b64c..00000000
--- a/modules/pfr/custom/shortenfastaids/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-custom/shortenfastaids:
-  - "modules/pfr/custom/shortenfastaids/**"
diff --git a/modules/pfr/ltrfinder/tests/tags.yml b/modules/pfr/ltrfinder/tests/tags.yml
deleted file mode 100644
index 006ded2c..00000000
--- a/modules/pfr/ltrfinder/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-ltrfinder:
-  - "modules/nf-core/ltrfinder/**"
diff --git a/modules/pfr/ltrharvest/tests/main.nf.test b/modules/pfr/ltrharvest/tests/main.nf.test
deleted file mode 100644
index 76b49476..00000000
--- a/modules/pfr/ltrharvest/tests/main.nf.test
+++ /dev/null
@@ -1,60 +0,0 @@
-nextflow_process {
-
-    name "Test Process LTRHARVEST"
-    script "../main.nf"
-    process "LTRHARVEST"
-
-    tag "modules"
-    tag "modules_nfcore"
-    tag "ltrharvest"
-
-    test("homo_sapiens-genome_21_fasta") {
-
-        when {
-            process {
-                """
-                input[0] = [
-                    [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
-                ]
-                """
-            }
-        }
-
-        then {
-            assertAll(
-                { assert process.success },
-                { assert snapshot(process.out.gff3).match("gff3") },
-                { assert path(process.out.scn[0][1]).text.contains("46510803 46520182 9380 46510803 46510940 138 46520042 46520182 141 86.52 0 chr21") },
-                { assert snapshot(path(process.out.versions[0]).text).match("script_versions") }
-            )
-        }
-
-    }
-
-    test("homo_sapiens-genome_fasta-stub") {
-
-        options '-stub'
-
-        when {
-            process {
-                """
-                input[0] = [
-                    [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
-                ]
-                """
-            }
-        }
-
-        then {
-            assertAll(
-                { assert process.success },
-                { assert snapshot(process.out).match() },
-                { assert snapshot(path(process.out.versions[0]).text).match("stub_versions") }
-            )
-        }
-
-    }
-
-}
\ No newline at end of file
diff --git a/modules/pfr/ltrharvest/tests/tags.yml b/modules/pfr/ltrharvest/tests/tags.yml
deleted file mode 100644
index 92de225e..00000000
--- a/modules/pfr/ltrharvest/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-ltrharvest:
-  - "modules/nf-core/ltrharvest/**"
diff --git a/modules/pfr/ltrretriever/ltrretriever/tests/nextflow.config b/modules/pfr/ltrretriever/ltrretriever/tests/nextflow.config
deleted file mode 100644
index 11499594..00000000
--- a/modules/pfr/ltrretriever/ltrretriever/tests/nextflow.config
+++ /dev/null
@@ -1,21 +0,0 @@
-process {
-
-    withName: GT_SUFFIXERATOR {
-        ext.args = '-suf -lcp'
-        // GT_LTRHARVEST requires -suf, -lcp
-    }
-
-    withName: LTRFINDER {
-        ext.args = '-harvest_out'
-        // LTRRETRIEVER requires -harvest_out
-    }
-
-    withName: GT_LTRHARVEST {
-        ext.args = '-minlenltr 100 -maxlenltr 7000 -mintsd 4 -maxtsd 6 -motif TGCA -motifmis 1 -similar 85 -vic 10 -seed 20 -seqids yes'
-        // recommended parameters: https://github.com/oushujun/LTR_retriever#usage
-    }
-
-    withName: CAT_CAT {
-        ext.prefix = { "${meta.id}_ltrharvest_ltrfinder.tabout" }
-    }
-}
diff --git a/modules/pfr/ltrretriever/ltrretriever/tests/tags.yml b/modules/pfr/ltrretriever/ltrretriever/tests/tags.yml
deleted file mode 100644
index 67241ccb..00000000
--- a/modules/pfr/ltrretriever/ltrretriever/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-ltrretriever/ltrretriever:
-  - "modules/nf-core/ltrretriever/ltrretriever/**"
diff --git a/modules/pfr/merqury/hapmers/tests/tags.yml b/modules/pfr/merqury/hapmers/tests/tags.yml
deleted file mode 100644
index 553f09d8..00000000
--- a/modules/pfr/merqury/hapmers/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-merqury/hapmers:
-  - "modules/pfr/merqury/hapmers/**"
diff --git a/modules/pfr/plotsr/tests/tags.yml b/modules/pfr/plotsr/tests/tags.yml
deleted file mode 100644
index 0a8616fd..00000000
--- a/modules/pfr/plotsr/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-plotsr:
-  - "modules/pfr/plotsr/**"
diff --git a/modules/pfr/syri/tests/tags.yml b/modules/pfr/syri/tests/tags.yml
deleted file mode 100644
index 3afda524..00000000
--- a/modules/pfr/syri/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-syri:
-  - "modules/pfr/syri/**"
diff --git a/nextflow.config b/nextflow.config
index 1f445720..88c9454a 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -280,11 +280,11 @@ manifest {
     name            = 'plant-food-research-open/assemblyqc'
     author          = """Usman Rashid, Ken Smith, Ross Crowhurst, Chen Wu, Marcus Davy"""
     homePage        = 'https://github.com/plant-food-research-open/assemblyqc'
-    description     = """A NextFlow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report."""
+    description     = """A Nextflow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report."""
     mainScript      = 'main.nf'
     nextflowVersion = '!>=23.04.0'
-    version         = '2.0.0'
-    doi             = 'https://doi.org/10.5281/zenodo.10647870'
+    version         = '2.1.0'
+    doi             = 'https://doi.org/10.1093/bioinformatics/btae477'
 }
 
 // Load modules.config for DSL2 module specific options
diff --git a/nextflow_schema.json b/nextflow_schema.json
index 1fee6de3..04dd3634 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -1,8 +1,8 @@
 {
     "$schema": "http://json-schema.org/draft-07/schema",
-    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/master/nextflow_schema.json",
+    "$id": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/main/nextflow_schema.json",
     "title": "plant-food-research-open/assemblyqc pipeline parameters",
-    "description": "A NextFlow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.",
+    "description": "A Nextflow pipeline which evaluates assembly quality with multiple QC tools and presents the results in a unified html report.",
     "type": "object",
     "definitions": {
         "input_output_options": {
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/main.nf b/subworkflows/gallvp/fasta_gxf_busco_plot/main.nf
similarity index 98%
rename from subworkflows/pfr/fasta_gxf_busco_plot/main.nf
rename to subworkflows/gallvp/fasta_gxf_busco_plot/main.nf
index 555087d4..3e8ad287 100644
--- a/subworkflows/pfr/fasta_gxf_busco_plot/main.nf
+++ b/subworkflows/gallvp/fasta_gxf_busco_plot/main.nf
@@ -1,8 +1,8 @@
-include { BUSCO_BUSCO as BUSCO_ASSEMBLY         } from '../../../modules/pfr/busco/busco/main'
-include { BUSCO_GENERATEPLOT as PLOT_ASSEMBLY   } from '../../../modules/pfr/busco/generateplot/main'
-include { GFFREAD as EXTRACT_PROTEINS           } from '../../../modules/pfr/gffread/main'
-include { BUSCO_BUSCO as BUSCO_ANNOTATION       } from '../../../modules/pfr/busco/busco/main'
-include { BUSCO_GENERATEPLOT as PLOT_ANNOTATION } from '../../../modules/pfr/busco/generateplot/main'
+include { BUSCO_BUSCO as BUSCO_ASSEMBLY         } from '../../../modules/gallvp/busco/busco/main'
+include { BUSCO_GENERATEPLOT as PLOT_ASSEMBLY   } from '../../../modules/gallvp/busco/generateplot/main'
+include { GFFREAD as EXTRACT_PROTEINS           } from '../../../modules/gallvp/gffread/main'
+include { BUSCO_BUSCO as BUSCO_ANNOTATION       } from '../../../modules/gallvp/busco/busco/main'
+include { BUSCO_GENERATEPLOT as PLOT_ANNOTATION } from '../../../modules/gallvp/busco/generateplot/main'
 
 workflow FASTA_GXF_BUSCO_PLOT {
 
@@ -166,3 +166,4 @@ workflow FASTA_GXF_BUSCO_PLOT {
     annotation_png                              = ch_annotation_png                     // channel: [ png ]
     versions                                    = ch_versions                           // channel: [ versions.yml ]
 }
+
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/meta.yml b/subworkflows/gallvp/fasta_gxf_busco_plot/meta.yml
similarity index 100%
rename from subworkflows/pfr/fasta_gxf_busco_plot/meta.yml
rename to subworkflows/gallvp/fasta_gxf_busco_plot/meta.yml
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/tests/main.nf.test b/subworkflows/gallvp/fasta_gxf_busco_plot/tests/main.nf.test
similarity index 73%
rename from subworkflows/pfr/fasta_gxf_busco_plot/tests/main.nf.test
rename to subworkflows/gallvp/fasta_gxf_busco_plot/tests/main.nf.test
index 8c8ac7b0..783be862 100644
--- a/subworkflows/pfr/fasta_gxf_busco_plot/tests/main.nf.test
+++ b/subworkflows/gallvp/fasta_gxf_busco_plot/tests/main.nf.test
@@ -6,7 +6,7 @@ nextflow_workflow {
     config './nextflow.config'
 
     tag "subworkflows"
-    tag "subworkflows_nfcore"
+    tag "subworkflows_gallvp"
     tag "subworkflows/fasta_gxf_busco_plot"
     tag "busco"
     tag "busco/busco"
@@ -21,17 +21,17 @@ nextflow_workflow {
                 input[0] = Channel.of(
                     [
                         [ id:'test' ], // meta map
-                        file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['genome_fasta'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/genome.fasta', checkIfExists: true)
                     ],
                     [
                         [ id:'test2' ], // meta map
-                        file( params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                     ]
                 )
                 input[1] = Channel.of(
                     [
                         [ id:'test' ], // meta map
-                        file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['test1_gff'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/gff/test1.gff', checkIfExists: true)
                     ]
                 )
                 input[2] = 'genome'
@@ -73,17 +73,17 @@ nextflow_workflow {
                 input[0] = Channel.of(
                     [
                         [ id:'test' ], // meta map
-                        file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['genome_fasta'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/genome.fasta', checkIfExists: true)
                     ],
                     [
                         [ id:'test2' ], // meta map
-                        file( params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true)
                     ]
                 )
                 input[1] = Channel.of(
                     [
                         [ id:'test' ], // meta map
-                        file( params.test_data['candidatus_portiera_aleyrodidarum']['genome']['test1_gff'], checkIfExists: true)
+                        file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/gff/test1.gff', checkIfExists: true)
                     ]
                 )
                 input[2] = 'genome'
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/tests/main.nf.test.snap b/subworkflows/gallvp/fasta_gxf_busco_plot/tests/main.nf.test.snap
similarity index 100%
rename from subworkflows/pfr/fasta_gxf_busco_plot/tests/main.nf.test.snap
rename to subworkflows/gallvp/fasta_gxf_busco_plot/tests/main.nf.test.snap
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/tests/nextflow.config b/subworkflows/gallvp/fasta_gxf_busco_plot/tests/nextflow.config
similarity index 100%
rename from subworkflows/pfr/fasta_gxf_busco_plot/tests/nextflow.config
rename to subworkflows/gallvp/fasta_gxf_busco_plot/tests/nextflow.config
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/main.nf b/subworkflows/gallvp/fasta_ltrretriever_lai/main.nf
similarity index 83%
rename from subworkflows/pfr/fasta_ltrretriever_lai/main.nf
rename to subworkflows/gallvp/fasta_ltrretriever_lai/main.nf
index 3820e69c..655fb1f4 100644
--- a/subworkflows/pfr/fasta_ltrretriever_lai/main.nf
+++ b/subworkflows/gallvp/fasta_ltrretriever_lai/main.nf
@@ -1,10 +1,11 @@
-include { CUSTOM_SHORTENFASTAIDS    } from '../../../modules/pfr/custom/shortenfastaids/main'
-include { LTRHARVEST                } from '../../../modules/pfr/ltrharvest/main'
-include { LTRFINDER                 } from '../../../modules/pfr/ltrfinder/main'
-include { LTRRETRIEVER_LTRRETRIEVER } from '../../../modules/pfr/ltrretriever/ltrretriever/main'
-include { CAT_CAT                   } from '../../../modules/pfr/cat/cat/main'
-include { LTRRETRIEVER_LAI          } from '../../../modules/pfr/ltrretriever/lai/main'
-include { CUSTOM_RESTOREGFFIDS      } from '../../../modules/pfr/custom/restoregffids/main'
+include { SEQKIT_SEQ as UNMASK_IF_ANY   } from '../../../modules/gallvp/seqkit/seq/main'
+include { CUSTOM_SHORTENFASTAIDS        } from '../../../modules/gallvp/custom/shortenfastaids/main'
+include { LTRHARVEST                    } from '../../../modules/gallvp/ltrharvest/main'
+include { LTRFINDER                     } from '../../../modules/gallvp/ltrfinder/main'
+include { LTRRETRIEVER_LTRRETRIEVER     } from '../../../modules/gallvp/ltrretriever/ltrretriever/main'
+include { CAT_CAT                       } from '../../../modules/gallvp/cat/cat/main'
+include { LTRRETRIEVER_LAI              } from '../../../modules/gallvp/ltrretriever/lai/main'
+include { CUSTOM_RESTOREGFFIDS          } from '../../../modules/gallvp/custom/restoregffids/main'
 
 workflow FASTA_LTRRETRIEVER_LAI {
 
@@ -24,8 +25,15 @@ workflow FASTA_LTRRETRIEVER_LAI {
                                     // Cater to channel: [ meta2, [] ]
                                     | map { meta2, seqs -> [ meta2.id, seqs ] }
 
+
+    // MODULE: SEQKIT_SEQ as UNMASK_IF_ANY
+    UNMASK_IF_ANY ( ch_fasta )
+
+    ch_unmasked_fasta               = UNMASK_IF_ANY.out.fastx
+    ch_versions                     = ch_versions.mix(UNMASK_IF_ANY.out.versions.first())
+
     // MOUDLE: CUSTOM_SHORTENFASTAIDS
-    CUSTOM_SHORTENFASTAIDS ( ch_fasta )
+    CUSTOM_SHORTENFASTAIDS ( ch_unmasked_fasta )
 
     ch_short_ids_tsv                = CUSTOM_SHORTENFASTAIDS.out.short_ids_tsv
     ch_shortenfastaids_branch       = ch_short_ids_tsv
@@ -36,7 +44,7 @@ workflow FASTA_LTRRETRIEVER_LAI {
 
     ch_short_ids_fasta              = ch_shortenfastaids_branch.nonchange
                                     | join(
-                                        ch_fasta
+                                        ch_unmasked_fasta
                                     )
                                     | map { meta, tsv, fasta -> [ meta, fasta ] }
                                     | mix(
@@ -102,6 +110,7 @@ workflow FASTA_LTRRETRIEVER_LAI {
         []
     )
 
+    ch_ltrretriever_log             = LTRRETRIEVER_LTRRETRIEVER.out.log
     ch_pass_list                    = LTRRETRIEVER_LTRRETRIEVER.out.pass_list
     ch_annotation_out               = LTRRETRIEVER_LTRRETRIEVER.out.annotation_out
     ch_pass_out                     = ch_pass_list.join(ch_annotation_out)
@@ -164,11 +173,12 @@ workflow FASTA_LTRRETRIEVER_LAI {
     ch_versions                     = ch_versions.mix(CUSTOM_RESTOREGFFIDS.out.versions.first())
 
     emit:
-    ltrlib                          = ch_ltrlib         // channel: [ val(meta), fasta ]
-    annotation_gff                  = ch_restored_gff   // channel: [ val(meta), gff ]
-    lai_log                         = ch_lai_log        // channel: [ val(meta), log ]
-    lai_out                         = ch_lai_out        // channel: [ val(meta), out ]
-    versions                        = ch_versions       // channel: [ versions.yml ]
+    ltrretriever_log                = ch_ltrretriever_log   // channel: [ val(meta), fasta ]
+    ltrlib                          = ch_ltrlib             // channel: [ val(meta), fasta ]
+    annotation_gff                  = ch_restored_gff       // channel: [ val(meta), gff ]
+    lai_log                         = ch_lai_log            // channel: [ val(meta), log ]
+    lai_out                         = ch_lai_out            // channel: [ val(meta), out ]
+    versions                        = ch_versions           // channel: [ versions.yml ]
 }
 
 
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/meta.yml b/subworkflows/gallvp/fasta_ltrretriever_lai/meta.yml
similarity index 99%
rename from subworkflows/pfr/fasta_ltrretriever_lai/meta.yml
rename to subworkflows/gallvp/fasta_ltrretriever_lai/meta.yml
index 5ba17303..57d6852b 100644
--- a/subworkflows/pfr/fasta_ltrretriever_lai/meta.yml
+++ b/subworkflows/gallvp/fasta_ltrretriever_lai/meta.yml
@@ -13,6 +13,7 @@ keywords:
   - stats
   - qc
 components:
+  - seqkit/seq
   - custom/shortenfastaids
   - ltrharvest
   - ltrfinder
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test
similarity index 65%
rename from subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test
rename to subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test
index a7fc65eb..7b4cf9fe 100644
--- a/subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test
+++ b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test
@@ -6,10 +6,11 @@ nextflow_workflow {
     config "./nextflow.config"
 
     tag "subworkflows"
-    tag "subworkflows_pfr"
+    tag "subworkflows_gallvp"
     tag "subworkflows/fasta_ltrretriever_lai"
     tag "fasta_ltrretriever_lai"
     tag "modules/nf-core/gunzip"
+    tag "seqkit/seq"
     tag "custom/shortenfastaids"
     tag "ltrharvest"
     tag "ltrfinder"
@@ -26,7 +27,7 @@ nextflow_workflow {
                 """
                 input[0] = [
                     [ id:'test' ],
-                    file(params.test_data['actinidia_chinensis']['genome']['genome_1_fasta_gz'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/eukaryotes/actinidia_chinensis/genome/chr1/genome.fasta.gz', checkIfExists: true)
                 ]
                 """
             }
@@ -53,7 +54,7 @@ nextflow_workflow {
                 { assert file(workflow.out.lai_log[0][1]).text.contains('Done!') },
                 { assert Math.abs(Float.parseFloat(path(workflow.out.lai_out[0][1]).text.split("\n")[1].split("\t")[6]) - 31.29) <= 1.0 },
                 { assert file(workflow.out.ltrlib[0][1]).text.contains('#LTR/Copia') },
-                { assert snapshot(workflow.out.versions).match("fasta_gz_versions") }
+                { assert snapshot(workflow.out.versions).match() }
             )
         }
     }
@@ -89,7 +90,7 @@ nextflow_workflow {
                 { assert file(workflow.out.lai_log[0][1]).text.contains('Done!') },
                 { assert Math.abs(Float.parseFloat(path(workflow.out.lai_out[0][1]).text.split("\n")[1].split("\t")[6]) - 31.29) <= 1.0 },
                 { assert file(workflow.out.ltrlib[0][1]).text.contains('#LTR/Copia') },
-                { assert snapshot(workflow.out.versions).match("with_mono_versions") }
+                { assert snapshot(workflow.out.versions).match() }
             )
         }
     }
@@ -122,7 +123,7 @@ nextflow_workflow {
                 { assert file(workflow.out.lai_log[0][1]).text.contains('Done!') },
                 { assert Math.abs(Float.parseFloat(path(workflow.out.lai_out[0][1]).text.split("\n")[1].split("\t")[6]) - 31.29) <= 1.0 },
                 { assert file(workflow.out.ltrlib[0][1]).text.contains('#LTR/Copia') },
-                { assert snapshot(workflow.out.versions).match("with_empty_mono_versions") }
+                { assert snapshot(workflow.out.versions).match() }
             )
         }
     }
@@ -151,4 +152,66 @@ nextflow_workflow {
             )
         }
     }
+
+    test("sarscov2 - fasta - noltr") {
+
+        when {
+            workflow {
+                """
+                input[0]            = Channel.of([
+                    [ id: 'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ])
+                input[1]            = []
+                input[2]            = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { path(workflow.out.ltrretriever_log[0][1]).text.contains('ERROR: No candidate is found in the file(s) you specified.') },
+                { assert snapshot(
+                    workflow.out.annotation_gff,
+                    workflow.out.lai_log,
+                    workflow.out.lai_out,
+                    workflow.out.ltrlib,
+                    workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("homo_sapiens - fasta") {
+
+        when {
+            workflow {
+                """
+                input[0]            = Channel.of([
+                    [ id: 'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome2.fasta', checkIfExists: true)
+                ])
+                input[1]            = []
+                input[2]            = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert file(workflow.out.annotation_gff[0][1]).text.contains('Gypsy_LTR_retrotransposon') },
+                { assert file(workflow.out.lai_log[0][1]).text.contains('Calculate LAI:') },
+                { assert file(workflow.out.lai_log[0][1]).text.contains('Sorry, LAI is not applicable on the current genome assembly.') },
+                { assert file(workflow.out.ltrlib[0][1]).text.contains('#LTR/Gypsy') },
+                { assert snapshot(
+                    workflow.out.versions,
+                    workflow.out.lai_out
+                    ).match()
+                }
+            )
+        }
+    }
 }
\ No newline at end of file
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test.snap b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test.snap
similarity index 61%
rename from subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test.snap
rename to subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test.snap
index e827219f..d1dcff99 100644
--- a/subworkflows/pfr/fasta_ltrretriever_lai/tests/main.nf.test.snap
+++ b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/main.nf.test.snap
@@ -1,43 +1,97 @@
 {
-    "fasta_gz_versions": {
+    "actinidia_chinensis-genome_1_fasta_gz-with_empty_mono": {
         "content": [
             [
                 "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
                 "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
                 "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
                 "versions.yml:md5,608d746d45680f025562c4be455db461",
                 "versions.yml:md5,8468404805dddec679524e75b4fa51e8",
+                "versions.yml:md5,9b2d5d76add82441b1e950d333e31307",
                 "versions.yml:md5,fb42c6cc5c28b6f9d3384171c7b6b143"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-06-02T20:28:52.168753"
+        "timestamp": "2024-07-29T09:23:40.519096"
     },
-    "with_empty_mono_versions": {
+    "sarscov2 - fasta - noltr": {
         "content": [
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
             [
                 "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
+                "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
+                "versions.yml:md5,608d746d45680f025562c4be455db461",
+                "versions.yml:md5,8468404805dddec679524e75b4fa51e8",
+                "versions.yml:md5,fb42c6cc5c28b6f9d3384171c7b6b143"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-29T09:24:10.73061"
+    },
+    "homo_sapiens - fasta": {
+        "content": [
+            [
+                "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
                 "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
                 "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
                 "versions.yml:md5,608d746d45680f025562c4be455db461",
                 "versions.yml:md5,8468404805dddec679524e75b4fa51e8",
                 "versions.yml:md5,9b2d5d76add82441b1e950d333e31307",
                 "versions.yml:md5,fb42c6cc5c28b6f9d3384171c7b6b143"
+            ],
+            [
+                
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-06-02T20:35:11.879068"
+        "timestamp": "2024-07-29T09:36:15.230271"
     },
-    "with_mono_versions": {
+    "actinidia_chinensis-genome_1_fasta_gz": {
         "content": [
             [
                 "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
+                "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
+                "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
+                "versions.yml:md5,608d746d45680f025562c4be455db461",
+                "versions.yml:md5,8468404805dddec679524e75b4fa51e8",
+                "versions.yml:md5,fb42c6cc5c28b6f9d3384171c7b6b143"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-29T09:17:04.823488"
+    },
+    "actinidia_chinensis-genome_1_fasta_gz-with_mono": {
+        "content": [
+            [
+                "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
                 "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
                 "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
                 "versions.yml:md5,608d746d45680f025562c4be455db461",
@@ -48,9 +102,9 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-06-02T20:30:58.393054"
+        "timestamp": "2024-07-29T09:20:22.223941"
     },
     "empty_fasta_stub": {
         "content": [
@@ -60,7 +114,7 @@
                         {
                             "id": "test"
                         },
-                        "test.LTRlib.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
                     ]
                 ],
                 "1": [
@@ -68,7 +122,7 @@
                         {
                             "id": "test"
                         },
-                        "test.out.gff3:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        "test.LTRlib.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
                     ]
                 ],
                 "2": [
@@ -76,7 +130,7 @@
                         {
                             "id": "test"
                         },
-                        "test.LAI.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        "test.out.gff3:md5,d41d8cd98f00b204e9800998ecf8427e"
                     ]
                 ],
                 "3": [
@@ -84,11 +138,20 @@
                         {
                             "id": "test"
                         },
-                        "test.LAI.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        "test.LAI.log:md5,d41d8cd98f00b204e9800998ecf8427e"
                     ]
                 ],
                 "4": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.LAI.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "5": [
                     "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                    "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
                     "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
                     "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
                     "versions.yml:md5,608d746d45680f025562c4be455db461",
@@ -127,8 +190,17 @@
                         "test.LTRlib.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
                     ]
                 ],
+                "ltrretriever_log": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
                 "versions": [
                     "versions.yml:md5,05a74dacbcd6c5906faeca3206f6563f",
+                    "versions.yml:md5,4b491828a96bf34cfac8268152ac7a77",
                     "versions.yml:md5,52a98b45c3cf73f9314dbe9b34eca9d8",
                     "versions.yml:md5,5d86cda262f5c21e43738433a2781ebc",
                     "versions.yml:md5,608d746d45680f025562c4be455db461",
@@ -139,8 +211,8 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "24.04.2"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-06-04T13:50:48.75158"
+        "timestamp": "2024-07-29T09:23:53.423404"
     }
 }
\ No newline at end of file
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/tests/nextflow.config b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/nextflow.config
similarity index 75%
rename from subworkflows/pfr/fasta_ltrretriever_lai/tests/nextflow.config
rename to subworkflows/gallvp/fasta_ltrretriever_lai/tests/nextflow.config
index 617b1160..fb642818 100644
--- a/subworkflows/pfr/fasta_ltrretriever_lai/tests/nextflow.config
+++ b/subworkflows/gallvp/fasta_ltrretriever_lai/tests/nextflow.config
@@ -11,4 +11,8 @@ process {
     withName: CAT_CAT {
         ext.prefix = { "${meta.id}_ltrharvest_ltrfinder.tabout" }
     }
+
+    withName: UNMASK_IF_ANY {
+        ext.args = '-u' // Change lowercase to uppercase
+    }
 }
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/main.nf b/subworkflows/gallvp/fastq_bwa_mem_samblaster/main.nf
similarity index 89%
rename from subworkflows/pfr/fastq_bwa_mem_samblaster/main.nf
rename to subworkflows/gallvp/fastq_bwa_mem_samblaster/main.nf
index 456f36c7..3d8d705d 100644
--- a/subworkflows/pfr/fastq_bwa_mem_samblaster/main.nf
+++ b/subworkflows/gallvp/fastq_bwa_mem_samblaster/main.nf
@@ -1,6 +1,6 @@
-include { BWA_INDEX         } from '../../../modules/pfr/bwa/index/main'
-include { BWA_MEM           } from '../../../modules/pfr/bwa/mem/main'
-include { SAMBLASTER        } from '../../../modules/pfr/samblaster/main'
+include { BWA_INDEX         } from '../../../modules/gallvp/bwa/index/main'
+include { BWA_MEM           } from '../../../modules/gallvp/bwa/mem/main'
+include { SAMBLASTER        } from '../../../modules/gallvp/samblaster/main'
 
 workflow FASTQ_BWA_MEM_SAMBLASTER {
 
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/meta.yml b/subworkflows/gallvp/fastq_bwa_mem_samblaster/meta.yml
similarity index 100%
rename from subworkflows/pfr/fastq_bwa_mem_samblaster/meta.yml
rename to subworkflows/gallvp/fastq_bwa_mem_samblaster/meta.yml
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/main.nf.test b/subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/main.nf.test
similarity index 61%
rename from subworkflows/pfr/fastq_bwa_mem_samblaster/tests/main.nf.test
rename to subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/main.nf.test
index 0a84fd8c..e36282d9 100644
--- a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/main.nf.test
+++ b/subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/main.nf.test
@@ -6,7 +6,7 @@ nextflow_workflow {
     config './nextflow.config'
 
     tag "subworkflows"
-    tag "subworkflows_nfcore"
+    tag "subworkflows_gallvp"
     tag "subworkflows/fastq_bwa_mem_samblaster"
     tag "samblaster"
     tag "bwa/index"
@@ -22,13 +22,13 @@ nextflow_workflow {
                     [
                         [ id:'test' ],
                         [
-                            file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-                            file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                            file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                            file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
                         ]
                     ]
                 )
                 input[1] = Channel.of(
-                    [ [ id: 'genome' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), [] ]
+                    [ [ id: 'genome' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), [] ]
                 )
                 """
             }
@@ -53,13 +53,13 @@ nextflow_workflow {
                     [
                         [ id:'test' ],
                         [
-                            file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-                            file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                            file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                            file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
                         ]
                     ]
                 )
                 input[1] = Channel.of(
-                    [ [ id: 'genome' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), [] ]
+                    [ [ id: 'genome' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), [] ]
                 )
                 """
             }
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/main.nf.test.snap b/subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/main.nf.test.snap
similarity index 100%
rename from subworkflows/pfr/fastq_bwa_mem_samblaster/tests/main.nf.test.snap
rename to subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/main.nf.test.snap
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/nextflow.config b/subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/nextflow.config
similarity index 100%
rename from subworkflows/pfr/fastq_bwa_mem_samblaster/tests/nextflow.config
rename to subworkflows/gallvp/fastq_bwa_mem_samblaster/tests/nextflow.config
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/main.nf b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/main.nf
similarity index 97%
rename from subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/main.nf
rename to subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/main.nf
index 3891fc81..07608710 100644
--- a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/main.nf
+++ b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/main.nf
@@ -1,7 +1,7 @@
-include { GT_GFF3                               } from '../../../modules/pfr/gt/gff3/main'
-include { SAMTOOLS_FAIDX                        } from '../../../modules/pfr/samtools/faidx/main'
-include { GT_GFF3VALIDATOR                      } from '../../../modules/pfr/gt/gff3validator/main'
-include { GT_STAT                               } from '../../../modules/pfr/gt/stat/main'
+include { GT_GFF3                               } from '../../../modules/gallvp/gt/gff3/main'
+include { SAMTOOLS_FAIDX                        } from '../../../modules/gallvp/samtools/faidx/main'
+include { GT_GFF3VALIDATOR                      } from '../../../modules/gallvp/gt/gff3validator/main'
+include { GT_STAT                               } from '../../../modules/gallvp/gt/stat/main'
 
 workflow GFF3_GT_GFF3_GFF3VALIDATOR_STAT {
 
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/meta.yml b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/meta.yml
similarity index 100%
rename from subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/meta.yml
rename to subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/meta.yml
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test
similarity index 77%
rename from subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test
rename to subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test
index f15972fa..6098d7da 100644
--- a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test
+++ b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test
@@ -6,7 +6,7 @@ nextflow_workflow {
     config "./nextflow.config"
 
     tag "subworkflows"
-    tag "subworkflows_nfcore"
+    tag "subworkflows_gallvp"
     tag "subworkflows/gff3_gt_gff3_gff3validator_stat"
     tag "gff3_gt_gff3_gff3validator_stat"
     tag "gt"
@@ -22,10 +22,10 @@ nextflow_workflow {
             workflow {
                 """
                 input[0] = Channel.of([ [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ])
                 input[1] = Channel.of([ [ id:'test' ],
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ])
                 """
             }
@@ -45,10 +45,10 @@ nextflow_workflow {
             workflow {
                 """
                 input[0] = Channel.of([ [ id:'test' ], // meta map
-                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.bed', checkIfExists: true)
                 ])
                 input[1] = Channel.of([ [ id:'test' ],
-                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
                 ])
                 """
             }
@@ -68,10 +68,10 @@ nextflow_workflow {
             workflow {
                 """
                 input[0] = Channel.of([ [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ])
                 input[1] = Channel.of([ [ id:'test' ],
-                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
                 ])
                 """
             }
@@ -98,7 +98,7 @@ nextflow_workflow {
                 test_fasta.text = '>MT192765.1\\nAGCTAGCT'
 
                 input[0] = Channel.of([ [ id:'test' ], // meta map
-                    file(params.test_data['sarscov2']['genome']['genome_gff3'], checkIfExists: true)
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3', checkIfExists: true)
                 ])
                 input[1] = Channel.of([ [ id:'test' ],
                     test_fasta.toPath()
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap
similarity index 82%
rename from subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap
rename to subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap
index 57aadb93..e81b4459 100644
--- a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap
+++ b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/main.nf.test.snap
@@ -18,7 +18,7 @@
                 ],
                 "3": [
                     "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
-                    "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                    "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106"
                 ],
                 "gff3_stats": [
                     
@@ -36,15 +36,15 @@
                 ],
                 "versions": [
                     "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
-                    "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                    "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106"
                 ]
             }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-09T19:41:05.240982"
+        "timestamp": "2024-07-29T16:21:54.482267"
     },
     "sarscov2-genome_gff3-test_fasta-correspondence_fail-out_of_bounds": {
         "content": [
@@ -53,15 +53,15 @@
             ],
             [
                 "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
-                "versions.yml:md5,c89b081a13c68acc5326e43ca9104344",
-                "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106",
+                "versions.yml:md5,c89b081a13c68acc5326e43ca9104344"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-09T19:41:16.606045"
+        "timestamp": "2024-07-29T16:22:06.684959"
     },
     "sarscov2-genome_gff3-homo_sapiens-genome_fasta-correspondence_fail": {
         "content": [
@@ -70,15 +70,15 @@
             ],
             [
                 "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
-                "versions.yml:md5,c89b081a13c68acc5326e43ca9104344",
-                "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106",
+                "versions.yml:md5,c89b081a13c68acc5326e43ca9104344"
             ]
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-09T19:41:11.28855"
+        "timestamp": "2024-07-29T16:22:00.684573"
     },
     "sarscov2-genome_gff3-all_pass": {
         "content": [
@@ -105,8 +105,8 @@
                 "3": [
                     "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
                     "versions.yml:md5,80555fe6e28e9564cb534f5478842286",
-                    "versions.yml:md5,c89b081a13c68acc5326e43ca9104344",
-                    "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                    "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106",
+                    "versions.yml:md5,c89b081a13c68acc5326e43ca9104344"
                 ],
                 "gff3_stats": [
                     [
@@ -130,15 +130,15 @@
                 "versions": [
                     "versions.yml:md5,0cb9519e626e5128d8495cf29b7d59ff",
                     "versions.yml:md5,80555fe6e28e9564cb534f5478842286",
-                    "versions.yml:md5,c89b081a13c68acc5326e43ca9104344",
-                    "versions.yml:md5,d81758cb7178ee32a1fb78f8639504d8"
+                    "versions.yml:md5,8a418ac34d045b0cdac812eb2dc9c106",
+                    "versions.yml:md5,c89b081a13c68acc5326e43ca9104344"
                 ]
             }
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.3"
         },
-        "timestamp": "2024-05-10T09:03:38.938037"
+        "timestamp": "2024-07-29T16:21:49.138904"
     }
 }
\ No newline at end of file
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/nextflow.config b/subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/nextflow.config
similarity index 100%
rename from subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/nextflow.config
rename to subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/tests/nextflow.config
diff --git a/subworkflows/local/fasta_synteny.nf b/subworkflows/local/fasta_synteny.nf
index 0ca879f5..6418d7e6 100644
--- a/subworkflows/local/fasta_synteny.nf
+++ b/subworkflows/local/fasta_synteny.nf
@@ -11,10 +11,10 @@ include { RELABELFASTALENGTH            } from '../../modules/local/relabelfasta
 include { GENERATEKARYOTYPE             } from '../../modules/local/generatekaryotype'
 include { CIRCOS                        } from '../../modules/local/circos'
 include { LINEARSYNTENY                 } from '../../modules/local/linearsynteny'
-include { CUSTOM_RELABELFASTA           } from '../../modules/pfr/custom/relabelfasta/main'
+include { CUSTOM_RELABELFASTA           } from '../../modules/gallvp/custom/relabelfasta/main'
 include { MINIMAP2_ALIGN                } from '../../modules/nf-core/minimap2/align/main'
-include { SYRI                          } from '../../modules/pfr/syri/main'
-include { PLOTSR                        } from '../../modules/pfr/plotsr/main'
+include { SYRI                          } from '../../modules/gallvp/syri/main'
+include { PLOTSR                        } from '../../modules/gallvp/plotsr/main'
 
 workflow FASTA_SYNTENY {
     take:
@@ -306,6 +306,7 @@ workflow FASTA_SYNTENY {
         ch_minimap_inputs.map { meta, tfa, rfa -> [ meta, tfa ] },
         ch_minimap_inputs.map { meta, tfa, rfa -> [ meta, rfa ] },
         true,   // bam_format
+        'bai',  // bam_index_extension
         false,  // cigar_paf_format
         false   // cigar_bam
     )
@@ -342,7 +343,7 @@ workflow FASTA_SYNTENY {
                                         | groupTuple
                                         | map { meta, syri, fastas ->
                                             def fasta_list          = fastas.flatten()
-                                            def syri_tags           = syri.collect { it.name.replace('syri.out', '').tokenize('.on.') }.flatten().unique()
+                                            def syri_tags           = syri.collect { it.name.replace('syri.out', '').split(/\.on\./).toList() }.flatten().unique()
                                             def proposed_order      = plotsr_assembly_order ? plotsr_assembly_order.tokenize(' ') : syri_tags.sort(false)
 
                                             def available_tags      = []
diff --git a/subworkflows/local/fq2hic.nf b/subworkflows/local/fq2hic.nf
index 38761473..34a7fa4e 100644
--- a/subworkflows/local/fq2hic.nf
+++ b/subworkflows/local/fq2hic.nf
@@ -1,14 +1,14 @@
-include { FASTQ_TRIM_FASTP_FASTQC   } from '../nf-core/fastq_trim_fastp_fastqc/main'
-include { FASTQ_BWA_MEM_SAMBLASTER  } from '../pfr/fastq_bwa_mem_samblaster/main'
-include { SEQKIT_SORT               } from '../../modules/nf-core/seqkit/sort/main'
-include { HICQC                     } from '../../modules/local/hicqc'
-include { MAKEAGPFROMFASTA          } from '../../modules/local/makeagpfromfasta'
-include { AGP2ASSEMBLY              } from '../../modules/local/agp2assembly'
-include { ASSEMBLY2BEDPE            } from '../../modules/local/assembly2bedpe'
-include { MATLOCK_BAM2_JUICER       } from '../../modules/local/matlock_bam2_juicer'
-include { JUICER_SORT               } from '../../modules/local/juicer_sort'
-include { RUNASSEMBLYVISUALIZER     } from '../../modules/local/runassemblyvisualizer'
-include { HIC2HTML                  } from '../../modules/local/hic2html'
+include { FASTQ_FASTQC_UMITOOLS_FASTP   } from '../nf-core/fastq_fastqc_umitools_fastp/main'
+include { FASTQ_BWA_MEM_SAMBLASTER      } from '../gallvp/fastq_bwa_mem_samblaster/main'
+include { SEQKIT_SORT                   } from '../../modules/nf-core/seqkit/sort/main'
+include { HICQC                         } from '../../modules/local/hicqc'
+include { MAKEAGPFROMFASTA              } from '../../modules/local/makeagpfromfasta'
+include { AGP2ASSEMBLY                  } from '../../modules/local/agp2assembly'
+include { ASSEMBLY2BEDPE                } from '../../modules/local/assembly2bedpe'
+include { MATLOCK_BAM2_JUICER           } from '../../modules/local/matlock_bam2_juicer'
+include { JUICER_SORT                   } from '../../modules/local/juicer_sort'
+include { RUNASSEMBLYVISUALIZER         } from '../../modules/local/runassemblyvisualizer'
+include { HIC2HTML                      } from '../../modules/local/hic2html'
 
 workflow FQ2HIC {
     take:
@@ -20,18 +20,22 @@ workflow FQ2HIC {
     main:
     ch_versions                     = Channel.empty()
 
-    // SUBWORKFLOW: FASTQ_TRIM_FASTP_FASTQC
-    FASTQ_TRIM_FASTP_FASTQC(
+    // SUBWORKFLOW: FASTQ_FASTQC_UMITOOLS_FASTP
+    FASTQ_FASTQC_UMITOOLS_FASTP(
         reads,
-        [],
-        true,                       // val_save_trimmed_fail
-        false,                      // val_save_merged
+        hic_skip_fastqc,
+        false,                      // with_umi
+        true,                       // skip_umi_extract
+        0,                          // umi_discard_read
         hic_skip_fastp,
-        hic_skip_fastqc
+        [],                         // adapter_fasta
+        true,                       // save_trimmed_fail
+        false,                      // save_merged
+        1                           // min_trimmed_reads
     )
 
-    ch_trim_reads                   = FASTQ_TRIM_FASTP_FASTQC.out.reads
-    ch_versions                     = ch_versions.mix(FASTQ_TRIM_FASTP_FASTQC.out.versions)
+    ch_trim_reads                   = FASTQ_FASTQC_UMITOOLS_FASTP.out.reads
+    ch_versions                     = ch_versions.mix(FASTQ_FASTQC_UMITOOLS_FASTP.out.versions)
 
     // MODULE: SEQKIT_SORT
     SEQKIT_SORT ( ref )
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf
new file mode 100644
index 00000000..ab6cbb32
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf
@@ -0,0 +1,164 @@
+//
+// Read QC, UMI extraction and trimming
+//
+
+include { FASTQC as FASTQC_RAW  } from '../../../modules/nf-core/fastqc/main'
+include { FASTQC as FASTQC_TRIM } from '../../../modules/nf-core/fastqc/main'
+include { UMITOOLS_EXTRACT      } from '../../../modules/nf-core/umitools/extract/main'
+include { FASTP                 } from '../../../modules/nf-core/fastp/main'
+
+//
+// Function that parses fastp json output file to get total number of reads after trimming
+//
+import groovy.json.JsonSlurper
+
+def getFastpReadsAfterFiltering(json_file, min_num_reads) {
+
+    if ( workflow.stubRun ) { return min_num_reads }
+
+    def Map json = (Map) new JsonSlurper().parseText(json_file.text).get('summary')
+    return json['after_filtering']['total_reads'].toLong()
+}
+
+def getFastpAdapterSequence(json_file){
+
+    if ( workflow.stubRun ) { return "" }
+
+    def Map json = (Map) new JsonSlurper().parseText(json_file.text)
+    try{
+        adapter = json['adapter_cutting']['read1_adapter_sequence']
+    } catch(Exception ex){
+        adapter = ""
+    }
+    return adapter
+}
+
+workflow FASTQ_FASTQC_UMITOOLS_FASTP {
+    take:
+    reads             // channel: [ val(meta), [ reads ] ]
+    skip_fastqc       // boolean: true/false
+    with_umi          // boolean: true/false
+    skip_umi_extract  // boolean: true/false
+    umi_discard_read  // integer: 0, 1 or 2
+    skip_trimming     // boolean: true/false
+    adapter_fasta     // file: adapter.fasta
+    save_trimmed_fail // boolean: true/false
+    save_merged       // boolean: true/false
+    min_trimmed_reads // integer: > 0
+
+    main:
+    ch_versions = Channel.empty()
+    fastqc_raw_html = Channel.empty()
+    fastqc_raw_zip  = Channel.empty()
+    if (!skip_fastqc) {
+        FASTQC_RAW (
+            reads
+        )
+        fastqc_raw_html = FASTQC_RAW.out.html
+        fastqc_raw_zip  = FASTQC_RAW.out.zip
+        ch_versions     = ch_versions.mix(FASTQC_RAW.out.versions.first())
+    }
+
+    umi_reads = reads
+    umi_log   = Channel.empty()
+    if (with_umi && !skip_umi_extract) {
+        UMITOOLS_EXTRACT (
+            reads
+        )
+        umi_reads   = UMITOOLS_EXTRACT.out.reads
+        umi_log     = UMITOOLS_EXTRACT.out.log
+        ch_versions = ch_versions.mix(UMITOOLS_EXTRACT.out.versions.first())
+
+        // Discard R1 / R2 if required
+        if (umi_discard_read in [1,2]) {
+            UMITOOLS_EXTRACT
+                .out
+                .reads
+                .map {
+                    meta, reads ->
+                        meta.single_end ? [ meta, reads ] : [ meta + [single_end: true], reads[umi_discard_read % 2] ]
+                }
+                .set { umi_reads }
+        }
+    }
+
+    trim_reads        = umi_reads
+    trim_json         = Channel.empty()
+    trim_html         = Channel.empty()
+    trim_log          = Channel.empty()
+    trim_reads_fail   = Channel.empty()
+    trim_reads_merged = Channel.empty()
+    fastqc_trim_html  = Channel.empty()
+    fastqc_trim_zip   = Channel.empty()
+    trim_read_count   = Channel.empty()
+    adapter_seq       = Channel.empty()
+
+    if (!skip_trimming) {
+        FASTP (
+            umi_reads,
+            adapter_fasta,
+            false, // don't want to set discard_trimmed_pass, else there will be no reads output
+            save_trimmed_fail,
+            save_merged
+        )
+        trim_json         = FASTP.out.json
+        trim_html         = FASTP.out.html
+        trim_log          = FASTP.out.log
+        trim_reads_fail   = FASTP.out.reads_fail
+        trim_reads_merged = FASTP.out.reads_merged
+        ch_versions       = ch_versions.mix(FASTP.out.versions.first())
+
+        //
+        // Filter FastQ files based on minimum trimmed read count after adapter trimming
+        //
+        FASTP
+            .out
+            .reads
+            .join(trim_json)
+            .map { meta, reads, json -> [ meta, reads, getFastpReadsAfterFiltering(json, min_trimmed_reads.toLong()) ] }
+            .set { ch_num_trimmed_reads }
+
+        ch_num_trimmed_reads
+            .filter { meta, reads, num_reads -> num_reads >= min_trimmed_reads.toLong() }
+            .map { meta, reads, num_reads -> [ meta, reads ] }
+            .set { trim_reads }
+
+        ch_num_trimmed_reads
+            .map { meta, reads, num_reads -> [ meta, num_reads ] }
+            .set { trim_read_count }
+
+        trim_json
+            .map { meta, json -> [meta, getFastpAdapterSequence(json)] }
+            .set { adapter_seq }
+
+        if (!skip_fastqc) {
+            FASTQC_TRIM (
+                trim_reads
+            )
+            fastqc_trim_html = FASTQC_TRIM.out.html
+            fastqc_trim_zip  = FASTQC_TRIM.out.zip
+            ch_versions      = ch_versions.mix(FASTQC_TRIM.out.versions.first())
+        }
+    }
+
+    emit:
+    reads = trim_reads // channel: [ val(meta), [ reads ] ]
+
+    fastqc_raw_html    // channel: [ val(meta), [ html ] ]
+    fastqc_raw_zip     // channel: [ val(meta), [ zip ] ]
+
+    umi_log            // channel: [ val(meta), [ log ] ]
+    adapter_seq        // channel: [ val(meta), [ adapter_seq] ]
+
+    trim_json          // channel: [ val(meta), [ json ] ]
+    trim_html          // channel: [ val(meta), [ html ] ]
+    trim_log           // channel: [ val(meta), [ log ] ]
+    trim_reads_fail    // channel: [ val(meta), [ fastq.gz ] ]
+    trim_reads_merged  // channel: [ val(meta), [ fastq.gz ] ]
+    trim_read_count    // channel: [ val(meta), val(count) ]
+
+    fastqc_trim_html   // channel: [ val(meta), [ html ] ]
+    fastqc_trim_zip    // channel: [ val(meta), [ zip ] ]
+
+    versions = ch_versions.ifEmpty(null) // channel: [ versions.yml ]
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
new file mode 100644
index 00000000..9308fe9b
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
@@ -0,0 +1,129 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
+# yaml-language-server: $schema=yaml-schema.json
+name: "fastq_fastqc_umitools_fastp"
+description: Read QC, UMI extraction and trimming
+keywords:
+  - fastq
+  - fastqc
+  - qc
+  - UMI
+  - trimming
+  - fastp
+components:
+  - fastqc
+  - umitools/extract
+  - fastp
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test' ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+  - skip_fastqc:
+      type: boolean
+      description: |
+        Skip fastqc process
+  - with_umi:
+      type: boolean
+      description: |
+        With or without umi detection
+  - skip_umi_extract:
+      type: boolean
+      description: |
+        With or without umi extrection
+  - umi_discard_read:
+      type: integer
+      description: |
+        Discard R1 / R2 if required
+  - skip_trimming:
+      type: boolean
+      description: |
+        Allows to skip FastP execution
+  - adapter_fasta:
+      type: file
+      description: |
+        Fasta file of adapter sequences
+  - save_trimmed_fail:
+      type: boolean
+      description: |
+        Save trimmed fastqs of failed samples
+  - save_merged:
+      type: boolean
+      description: |
+        Save merged fastqs
+  - min_trimmed_reads:
+      type: integer
+      description: |
+        Inputs with fewer than this reads will be filtered out of the "reads" output channel
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test' ]
+  - reads:
+      type: file
+      description: >
+        Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
+        For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
+      pattern: "*.{fastq.gz}"
+  - fastqc_html:
+      type: file
+      description: FastQC report
+      pattern: "*_{fastqc.html}"
+  - fastqc_zip:
+      type: file
+      description: FastQC report archive
+      pattern: "*_{fastqc.zip}"
+  - log:
+      type: file
+      description: Logfile for umi_tools
+      pattern: "*.{log}"
+  - trim_json:
+      type: file
+      description: FastP Trimming report
+      pattern: "*.{fastp.json}"
+  - trim_html:
+      type: file
+      description: FastP Trimming report
+      pattern: "*.{fastp.html}"
+  - log:
+      type: file
+      description: Logfile FastP
+      pattern: "*.{fastp.log}"
+  - trim_reads_fail:
+      type: file
+      description: Trimmed fastq files failing QC
+      pattern: "*.{fastq.gz}"
+  - trim_reads_merged:
+      type: file
+      description: Trimmed and merged fastq files
+      pattern: "*.{fastq.gz}"
+  - trim_read_count:
+      type: integer
+      description: Number of reads after trimming
+  - fastqc_trim_html:
+      type: file
+      description: FastQC report
+      pattern: "*_{fastqc.html}"
+  - fastqc_trim_zip:
+      type: file
+      description: FastQC report archive
+      pattern: "*_{fastqc.zip}"
+  - adapter_seq:
+      type: string
+      description: |
+        Adapter Sequence found in read1
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@robsyme"
+maintainers:
+  - "@robsyme"
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
new file mode 100644
index 00000000..48ba5f48
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
@@ -0,0 +1,973 @@
+nextflow_workflow {
+
+    name "Test Workflow FASTQ_FASTQC_UMITOOLS_FASTP"
+    script "../main.nf"
+    workflow "FASTQ_FASTQC_UMITOOLS_FASTP"
+    config './nextflow.config'
+
+    tag "subworkflows"
+    tag "subworkflows_nfcore"
+    tag "subworkflows/fastq_fastqc_umitools_fastp"
+    tag "fastq_fastqc_umitools_fastp"
+    tag "fastqc"
+    tag "umitools/extract"
+    tag "fastp"
+
+
+    test("sarscov2 paired-end [fastq]") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("skip_fastqc") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = true
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end: false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert !workflow.out.fastqc_raw_html },
+                { assert !workflow.out.fastqc_raw_zip },
+                { assert !workflow.out.fastqc_trim_html },
+                { assert !workflow.out.fastqc_trim_zip },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("with_umi") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+
+    test("skip_umi_extract") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("umi_discard_read = 2") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 2
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("skip_trimming") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = true
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert !workflow.out.fastqc_trim_html },
+                { assert !workflow.out.fastqc_trim_zip },
+                { assert !workflow.out.trim_html },
+                { assert !workflow.out.trim_log },
+                { assert snapshot(
+                        // If we skip trimming then input is output, so not snapshotting
+                        workflow.out.adapter_seq,
+                        workflow.out.reads.get(0).get(0), // Reads meta map
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("save_trimmed_fail") {
+
+        config './nextflow.save_trimmed.config'
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = true
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("save_merged") {
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("min_trimmed_reads = 26") {
+        // Subworkflow should stop after FASTP which trims down to 25 reads
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 26
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert snapshot(
+                        workflow.out.adapter_seq,
+                        workflow.out.reads,
+                        workflow.out.trim_json,
+                        workflow.out.trim_read_count,
+                        workflow.out.trim_reads_fail,
+                        workflow.out.trim_reads_merged,
+                        workflow.out.umi_log,
+                        workflow.out.versions
+                    ).match()
+                }
+            )
+        }
+    }
+
+    test("sarscov2 paired-end [fastq] - stub") {
+
+        options '-stub'
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("skip_fastqc - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = true
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end: false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("with_umi - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+
+    test("skip_umi_extract - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("umi_discard_read = 2 - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = true
+                skip_umi_extract  = true
+                umi_discard_read  = 2
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("skip_trimming - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = true
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(
+                    workflow.out.adapter_seq,
+                    workflow.out.fastqc_raw_html,
+                    workflow.out.fastqc_raw_zip,
+                    workflow.out.fastqc_trim_html,
+                    workflow.out.fastqc_trim_zip,
+                    workflow.out.trim_html,
+                    workflow.out.trim_json,
+                    workflow.out.trim_log,
+                    workflow.out.trim_read_count,
+                    workflow.out.trim_reads_fail,
+                    workflow.out.trim_reads_merged,
+                    workflow.out.umi_log,
+                    workflow.out.versions).match() }
+            )
+        }
+    }
+
+    test("save_trimmed_fail - stub") {
+
+        options "-stub"
+
+        config './nextflow.save_trimmed.config'
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = true
+                save_merged       = false
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("save_merged - stub") {
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 1
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+
+    test("min_trimmed_reads = 26 - stub") {
+        // Subworkflow should stop after FASTP which trims down to 25 reads
+
+        options "-stub"
+
+        when {
+            workflow {
+                """
+                skip_fastqc       = false
+                with_umi          = false
+                skip_umi_extract  = false
+                umi_discard_read  = 1
+                skip_trimming     = false
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+                min_trimmed_reads = 26
+
+                input[0] = Channel.of([
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+                        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+                    ]
+                ])
+                input[1] = skip_fastqc
+                input[2] = with_umi
+                input[3] = skip_umi_extract
+                input[4] = umi_discard_read
+                input[5] = skip_trimming
+                input[6] = adapter_fasta
+                input[7] = save_trimmed_fail
+                input[8] = save_merged
+                input[9] = min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out).match() }
+            )
+        }
+    }
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
new file mode 100644
index 00000000..e7d1f51e
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
@@ -0,0 +1,2407 @@
+{
+    "skip_fastqc": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:56:01.933832"
+    },
+    "save_trimmed_fail": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+                        "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    162
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+                        "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+                        "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+                    ]
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:57:38.736"
+    },
+    "skip_umi_extract": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:56:47.905105"
+    },
+    "umi_discard_read = 2": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:57:05.436744"
+    },
+    "umi_discard_read = 2 - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:59:27.273892"
+    },
+    "skip_trimming - stub": {
+        "content": [
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:59:39.247758"
+    },
+    "save_merged": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    75
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:57:57.472342"
+    },
+    "skip_trimming": {
+        "content": [
+            [
+                
+            ],
+            {
+                "id": "test",
+                "single_end": false
+            },
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:57:19.875543"
+    },
+    "with_umi": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    ""
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    99
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:56:26.778625"
+    },
+    "min_trimmed_reads = 26": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+                        "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    75
+                ]
+            ],
+            [
+                
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:58:16.36697"
+    },
+    "min_trimmed_reads = 26 - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        26
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        26
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T17:00:16.524361"
+    },
+    "with_umi - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:58:56.42517"
+    },
+    "skip_fastqc - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    
+                ],
+                "fastqc_raw_zip": [
+                    
+                ],
+                "fastqc_trim_html": [
+                    
+                ],
+                "fastqc_trim_zip": [
+                    
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:58:41.207281"
+    },
+    "save_merged - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T17:00:03.695409"
+    },
+    "sarscov2 paired-end [fastq]": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "unspecified"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:55:50.614571"
+    },
+    "sarscov2 paired-end [fastq] - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:58:29.296468"
+    },
+    "save_trimmed_fail - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:59:51.615894"
+    },
+    "skip_umi_extract - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "12": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "13": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "adapter_seq": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        ""
+                    ]
+                ],
+                "fastqc_raw_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_raw_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "fastqc_trim_zip": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "reads": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        [
+                            "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+                            "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                        ]
+                    ]
+                ],
+                "trim_html": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_json": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_log": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "trim_read_count": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        1
+                    ]
+                ],
+                "trim_reads_fail": [
+                    
+                ],
+                "trim_reads_merged": [
+                    
+                ],
+                "umi_log": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                    "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                    "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.3"
+        },
+        "timestamp": "2024-07-22T16:59:12.592278"
+    }
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config
new file mode 100644
index 00000000..0174cae5
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.config
@@ -0,0 +1,11 @@
+process {
+
+    withName: UMITOOLS_EXTRACT {
+        ext.args = '--bc-pattern="NNNN" --bc-pattern2="NNNN"'
+    }
+
+    withName: UMICOLLAPSE {
+        ext.prefix = { "${meta.id}.dedup" }
+    }
+
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config
new file mode 100644
index 00000000..21207add
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/nextflow.save_trimmed.config
@@ -0,0 +1,6 @@
+process {
+    // Make filtering more aggressive to make more reads fail
+    withName: FASTP {
+        ext.args = "-e 30"
+    }
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
new file mode 100644
index 00000000..84a4b567
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
@@ -0,0 +1,2 @@
+subworkflows/fastq_fastqc_umitools_fastp:
+  - subworkflows/nf-core/fastq_fastqc_umitools_fastp/**
diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf b/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf
deleted file mode 100644
index 4f1c84fc..00000000
--- a/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf
+++ /dev/null
@@ -1,103 +0,0 @@
-//
-// Read QC and trimming
-//
-
-include { FASTQC as FASTQC_RAW  } from '../../../modules/nf-core/fastqc/main'
-include { FASTQC as FASTQC_TRIM } from '../../../modules/nf-core/fastqc/main'
-include { FASTP                 } from '../../../modules/nf-core/fastp/main'
-
-//
-// Function that parses fastp json output file to get total number of reads after trimming
-//
-import groovy.json.JsonSlurper
-
-def getFastpReadsAfterFiltering(json_file) {
-    def Map json = (Map) new JsonSlurper().parseText(json_file.text).get('summary')
-    return json['after_filtering']['total_reads'].toLong()
-}
-
-workflow FASTQ_TRIM_FASTP_FASTQC {
-    take:
-    ch_reads              // channel: [ val(meta), path(reads)  ]
-    ch_adapter_fasta      // channel: [ path(fasta) ]
-    val_save_trimmed_fail // value: boolean
-    val_save_merged       // value: boolean
-    val_skip_fastp        // value: boolean
-    val_skip_fastqc       // value: boolean
-
-    main:
-
-    ch_versions = Channel.empty()
-
-    ch_fastqc_raw_html = Channel.empty()
-    ch_fastqc_raw_zip  = Channel.empty()
-    if (!val_skip_fastqc) {
-        FASTQC_RAW (
-            ch_reads
-        )
-        ch_fastqc_raw_html = FASTQC_RAW.out.html
-        ch_fastqc_raw_zip  = FASTQC_RAW.out.zip
-        ch_versions     = ch_versions.mix(FASTQC_RAW.out.versions.first())
-    }
-
-    ch_trim_reads        = ch_reads
-    ch_trim_json         = Channel.empty()
-    ch_trim_html         = Channel.empty()
-    ch_trim_log          = Channel.empty()
-    ch_trim_reads_fail   = Channel.empty()
-    ch_trim_reads_merged = Channel.empty()
-    ch_fastqc_trim_html  = Channel.empty()
-    ch_fastqc_trim_zip   = Channel.empty()
-    if (!val_skip_fastp) {
-        FASTP (
-            ch_reads,
-            ch_adapter_fasta,
-            val_save_trimmed_fail,
-            val_save_merged
-        )
-        ch_trim_reads        = FASTP.out.reads
-        ch_trim_json         = FASTP.out.json
-        ch_trim_html         = FASTP.out.html
-        ch_trim_log          = FASTP.out.log
-        ch_trim_reads_fail   = FASTP.out.reads_fail
-        ch_trim_reads_merged = FASTP.out.reads_merged
-        ch_versions       = ch_versions.mix(FASTP.out.versions.first())
-
-        //
-        // Filter empty FastQ files after adapter trimming so FastQC doesn't fail
-        //
-        ch_trim_reads
-            .join(ch_trim_json)
-            .map {
-                meta, reads, json ->
-                    if (getFastpReadsAfterFiltering(json) > 0) {
-                        [ meta, reads ]
-                    }
-            }
-            .set { ch_trim_reads }
-
-        if (!val_skip_fastqc) {
-            FASTQC_TRIM (
-                ch_trim_reads
-            )
-            ch_fastqc_trim_html = FASTQC_TRIM.out.html
-            ch_fastqc_trim_zip  = FASTQC_TRIM.out.zip
-            ch_versions      = ch_versions.mix(FASTQC_TRIM.out.versions.first())
-        }
-    }
-
-    emit:
-    reads             = ch_trim_reads         // channel: [ val(meta), path(reads) ]
-    trim_json         = ch_trim_json          // channel: [ val(meta), path(json) ]
-    trim_html         = ch_trim_html          // channel: [ val(meta), path(html) ]
-    trim_log          = ch_trim_log           // channel: [ val(meta), path(log) ]
-    trim_reads_fail   = ch_trim_reads_fail    // channel: [ val(meta), path(fastq.gz) ]
-    trim_reads_merged = ch_trim_reads_merged  // channel: [ val(meta), path(fastq.gz) ]
-
-    fastqc_raw_html  = ch_fastqc_raw_html    // channel: [ val(meta), path(html) ]
-    fastqc_raw_zip   = ch_fastqc_raw_zip     // channel: [ val(meta), path(zip) ]
-    fastqc_trim_html = ch_fastqc_trim_html   // channel: [ val(meta), path(html) ]
-    fastqc_trim_zip  = ch_fastqc_trim_zip    // channel: [ val(meta), path(zip) ]
-
-    versions = ch_versions.ifEmpty(null) // channel: [ path(versions.yml) ]
-}
diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml b/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml
deleted file mode 100644
index 9f4e12e0..00000000
--- a/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml
+++ /dev/null
@@ -1,108 +0,0 @@
-# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
-name: "fastq_trim_fastp_fastqc"
-description: Read QC, fastp trimming and read qc
-keywords:
-  - qc
-  - quality_control
-  - adapters
-  - trimming
-  - fastq
-components:
-  - fastqc
-  - fastp
-input:
-  - ch_reads:
-      type: file
-      description: |
-        Structure: [ val(meta), path (reads) ]
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ], List of input FastQ files of size 1 and 2 for single-end and paired-end data,
-        respectively. If you wish to run interleaved paired-end data,  supply as single-end data
-        but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module.
-  - ch_adapter_fasta:
-      type: file
-      description: |
-        Structure: path(adapter_fasta)
-        File in FASTA format containing possible adapters to remove.
-  - val_save_trimmed_fail:
-      type: boolean
-      description: |
-        Structure: val(save_trimmed_fail)
-        Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz`
-  - val_save_merged:
-      type: boolean
-      description: |
-        Structure: val(save_merged)
-        Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz`
-  - val_skip_fastqc:
-      type: boolean
-      description: |
-        Structure: val(skip_fastqc)
-        skip the fastqc process if true
-  - val_skip_fastp:
-      type: boolean
-      description: |
-        Structure: val(skip_fastp)
-        skip the fastp process if true
-output:
-  - meta:
-      type: value
-      description: Groovy Map containing sample information e.g. [ id:'test', single_end:false ]
-  - reads:
-      type: file
-      description: |
-        Structure: [ val(meta), path(reads) ]
-        The trimmed/modified/unmerged fastq reads
-  - trim_json:
-      type: file
-      description: |
-        Structure: [ val(meta), path(trim_json) ]
-        Results in JSON format
-  - trim_html:
-      type: file
-      description: |
-        Structure: [ val(meta), path(trim_html) ]
-        Results in HTML format
-  - trim_log:
-      type: file
-      description: |
-        Structure: [ val(meta), path(trim_log) ]
-        fastq log file
-  - trim_reads_fail:
-      type: file
-      description: |
-        Structure: [ val(meta), path(trim_reads_fail) ]
-        Reads the failed the preprocessing
-  - trim_reads_merged:
-      type: file
-      description: |
-        Structure: [ val(meta), path(trim_reads_merged) ]
-        Reads that were successfully merged
-  - fastqc_raw_html:
-      type: file
-      description: |
-        Structure: [ val(meta), path(fastqc_raw_html) ]
-        Raw fastQC report
-  - fastqc_raw_zip:
-      type: file
-      description: |
-        Structure: [ val(meta), path(fastqc_raw_zip) ]
-        Raw fastQC report archive
-  - fastqc_trim_html:
-      type: file
-      description: |
-        Structure: [ val(meta), path(fastqc_trim_html) ]
-        Trimmed fastQC report
-  - fastqc_trim_zip:
-      type: file
-      description: |
-        Structure: [ val(meta), path(fastqc_trim_zip) ]
-        Trimmed fastQC report archive
-  - versions:
-      type: file
-      description: File containing software versions
-      pattern: "versions.yml"
-authors:
-  - "@Joon-Klaps"
-maintainers:
-  - "@Joon-Klaps"
diff --git a/subworkflows/pfr/fasta_gxf_busco_plot/tests/tags.yml b/subworkflows/pfr/fasta_gxf_busco_plot/tests/tags.yml
deleted file mode 100644
index b8786a59..00000000
--- a/subworkflows/pfr/fasta_gxf_busco_plot/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/fasta_gxf_busco_plot:
-  - subworkflows/pfr/fasta_gxf_busco_plot/**
diff --git a/subworkflows/pfr/fasta_ltrretriever_lai/tests/tags.yml b/subworkflows/pfr/fasta_ltrretriever_lai/tests/tags.yml
deleted file mode 100644
index 9c15c67e..00000000
--- a/subworkflows/pfr/fasta_ltrretriever_lai/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/fasta_ltrretriever_lai:
-  - subworkflows/pfr/fasta_ltrretriever_lai/**
diff --git a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/tags.yml b/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/tags.yml
deleted file mode 100644
index 810ecdd8..00000000
--- a/subworkflows/pfr/fastq_bwa_mem_samblaster/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/fastq_bwa_mem_samblaster:
-  - subworkflows/pfr/fastq_bwa_mem_samblaster/**
diff --git a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/tags.yml b/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/tags.yml
deleted file mode 100644
index 2b0b9279..00000000
--- a/subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/gff3_gt_gff3_gff3validator_stat:
-  - subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/**
diff --git a/tests/README.md b/tests/README.md
new file mode 100644
index 00000000..257defe3
--- /dev/null
+++ b/tests/README.md
@@ -0,0 +1,27 @@
+# **plant-food-research-open/assemblyqc** Tests
+
+## Minimal Testing
+
+If [Nextflow](https://www.nextflow.io/docs/latest/install.html#install-nextflow) and [Docker](https://docs.docker.com/install) are installed on the system, the pipeline can be minimally tested with the following command:
+
+```bash
+nextflow run plant-food-research-open/assemblyqc -r main -profile docker,test --outdir results
+```
+
+Or using [singularity](https://docs.sylabs.io/guides/3.0/user-guide/installation.html):
+
+```bash
+nextflow run plant-food-research-open/assemblyqc -r main -profile singularity,test --outdir results
+```
+
+## Local Testing
+
+The test sets included in this directory can be executed by first downloading the pipeline from GitHub and then executing the following command:
+
+```bash
+./main.nf -profile docker -params-file tests/minimal/params.json --outdir results
+```
+
+## Continuous Integration (CI)
+
+The GitHub [CI action](../.github/workflows/ci.yml) included with the pipeline continuously tests the pipeline with the various test sets listed in this directory.
diff --git a/tests/noltr/assemblysheet.csv b/tests/noltr/assemblysheet.csv
new file mode 100644
index 00000000..9769e377
--- /dev/null
+++ b/tests/noltr/assemblysheet.csv
@@ -0,0 +1,3 @@
+tag,fasta
+sarscov2,https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/genomics/sarscov2/genome/genome.fasta
+FI1,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.fna.gz
diff --git a/tests/noltr/params.json b/tests/noltr/params.json
new file mode 100644
index 00000000..a46bd34d
--- /dev/null
+++ b/tests/noltr/params.json
@@ -0,0 +1,9 @@
+{
+    "config_profile_name": "No LTRs assembly profile",
+    "config_profile_description": "Profile to test an assembly without LTRs",
+    "input": "tests/noltr/assemblysheet.csv",
+    "lai_skip": false,
+    "max_cpus": 2,
+    "max_memory": "6.GB",
+    "max_time": "6.h"
+}
diff --git a/workflows/assemblyqc.nf b/workflows/assemblyqc.nf
index 1fa329ae..8f615b3e 100644
--- a/workflows/assemblyqc.nf
+++ b/workflows/assemblyqc.nf
@@ -11,15 +11,15 @@ include { GUNZIP as GUNZIP_GFF3             } from '../modules/nf-core/gunzip/ma
 include { FASTAVALIDATOR                    } from '../modules/nf-core/fastavalidator/main'
 include { SEQKIT_RMDUP                      } from '../modules/nf-core/seqkit/rmdup/main'
 include { FASTA_EXPLORE_SEARCH_PLOT_TIDK    } from '../subworkflows/nf-core/fasta_explore_search_plot_tidk/main'
-include { GFF3_GT_GFF3_GFF3VALIDATOR_STAT   } from '../subworkflows/pfr/gff3_gt_gff3_gff3validator_stat/main'
+include { GFF3_GT_GFF3_GFF3VALIDATOR_STAT   } from '../subworkflows/gallvp/gff3_gt_gff3_gff3validator_stat/main'
 include { FCS_FCSADAPTOR                    } from '../modules/nf-core/fcs/fcsadaptor/main'
 include { NCBI_FCS_GX                       } from '../subworkflows/local/ncbi_fcs_gx'
 include { ASSEMBLATHON_STATS                } from '../modules/local/assemblathon_stats'
-include { FASTA_GXF_BUSCO_PLOT              } from '../subworkflows/pfr/fasta_gxf_busco_plot/main'
-include { FASTA_LTRRETRIEVER_LAI            } from '../subworkflows/pfr/fasta_ltrretriever_lai/main'
+include { FASTA_GXF_BUSCO_PLOT              } from '../subworkflows/gallvp/fasta_gxf_busco_plot/main'
+include { FASTA_LTRRETRIEVER_LAI            } from '../subworkflows/gallvp/fasta_ltrretriever_lai/main'
 include { FASTA_KRAKEN2                     } from '../subworkflows/local/fasta_kraken2'
 include { FQ2HIC                            } from '../subworkflows/local/fq2hic'
-include { CAT_CAT as TAG_ASSEMBLY           } from '../modules/pfr/cat/cat/main'
+include { CAT_CAT as TAG_ASSEMBLY           } from '../modules/gallvp/cat/cat/main'
 include { FASTA_SYNTENY                     } from '../subworkflows/local/fasta_synteny'
 include { MERYL_COUNT                       } from '../modules/nf-core/meryl/count/main'
 include { MERYL_UNIONSUM                    } from '../modules/nf-core/meryl/unionsum/main'
@@ -27,7 +27,7 @@ include { MERYL_COUNT as MAT_MERYL_COUNT    } from '../modules/nf-core/meryl/cou
 include { MERYL_UNIONSUM as MAT_UNIONSUM    } from '../modules/nf-core/meryl/unionsum/main'
 include { MERYL_COUNT as PAT_MERYL_COUNT    } from '../modules/nf-core/meryl/count/main'
 include { MERYL_UNIONSUM as PAT_UNIONSUM    } from '../modules/nf-core/meryl/unionsum/main'
-include { MERQURY_HAPMERS                   } from '../modules/pfr/merqury/hapmers/main'
+include { MERQURY_HAPMERS                   } from '../modules/nf-core/merqury/hapmers/main'
 include { MERQURY_MERQURY                   } from '../modules/nf-core/merqury/merqury/main'
 include { CREATEREPORT                      } from '../modules/local/createreport'
 
@@ -535,6 +535,10 @@ workflow ASSEMBLYQC {
                                             // This partial join can't fail because both outputs are
                                             // from the same process
                                             | map { meta, log, out -> out ? [ log, out ] : [log] }
+                                            | mix(
+                                                FASTA_LTRRETRIEVER_LAI.out.ltrretriever_log
+                                                | map { meta, log -> log }
+                                            )
 
     ch_versions                             = ch_versions.mix(FASTA_LTRRETRIEVER_LAI.out.versions)