Check various lengths

seqreport/SeqCollection.py

@@ -19,13 +19,23 @@ class SeqCollection:
     > Fix overhead cost for each sequence part (cloning, delivery costs etc).
 
     **currency_symbol**
-    > The currency symbol to display in the report.
+    > The currency symbol (or string) to display in the report (`str`).
 
     **projectname**
     > The name of the project (`str`).
 
     **comments**
     > Any comments to be included in the report (`str`).
+
+    **min_length**
+    > Check that all sequences are at least this long (`int`).
+
+    **max_length**
+    > Check that all sequences are at most this long (`int`).
+
+    **name_length**
+    > Check which sequence IDs are longer than this cutoff. Genbank has a character
+    limit.
     """
 
     def __init__(
@@ -36,25 +46,44 @@ def __init__(
         currency_symbol="£",
         projectname="",
         comments="",
+        min_length=0,
+        max_length=0,
+        name_length=15,  # max seq record name length. Genbank character limit.
     ):
         self.sequences = records
         self.cost_per_base = cost_per_base
         self.cost_per_seq = cost_per_seq
         self.currency_symbol = currency_symbol
         self.projectname = projectname
         self.comments = comments
+        self.min_length = min_length
+        self.max_length = max_length
+        self.name_length = name_length
         self.calculate_values()
 
     def calculate_values(self):
         self.cost_per_base = float(self.cost_per_base)  # could be str after update
         self.cost_per_seq = float(self.cost_per_seq)
         self.n_seq = len(self.sequences)
+
         n_bp = 0
         for part in self.sequences:
             n_bp += len(part.seq)
         self.n_bp = n_bp
         self.cost = self.n_seq * self.cost_per_seq + self.n_bp * self.cost_per_base
 
+        self.too_short = []
+        self.too_long = []
+        self.long_names = []
+        for record in self.sequences:
+            if len(record) < self.min_length:
+                self.too_short += [record.id]
+            if self.max_length > 0:  # otherwise skip if default
+                if len(record) > self.max_length:
+                    self.too_long += [record.id]
+            if len(record.id) > self.name_length:
+                self.long_names += [record.id]
+
 
 def read_fasta(fasta):
     """Read a FASTA sequence file into a list of records.

seqreport/report_assets/seq_report.pug

@@ -21,6 +21,27 @@ p.
 p.
   Estimated cost: <b>{{ seqcollection.currency_symbol }} {{ seqcollection.cost }}</b>
 
+if seqcollection.too_short
+  p.
+    Sequences shorter than <b>{{ seqcollection.min_length }}</b> bp: {{ seqcollection.too_short }}
+else
+  p.
+    None of the sequences are shorter than <b>{{ seqcollection.min_length }}</b> bp.
+
+if seqcollection.too_long
+  p.
+    Sequences longer than <b>{{ seqcollection.max_length }}</b> bp: {{ seqcollection.too_long }}
+else
+  p.
+    None of the sequences are longer than <b>{{ seqcollection.max_length }}</b> bp.
+
+if seqcollection.long_names
+  p.
+    Sequence IDs longer than <b>{{ seqcollection.name_length }}</b> characters: {{ seqcollection.long_names }}
+else
+  p.
+    None of the IDs are longer than <b>{{ seqcollection.name_length }}</b> characters.
+
 if seqcollection.comments
   p.
     Comments: <i>{{ seqcollection.comments }}</i>

tests/data/test.fa

@@ -1,6 +1,6 @@
 >seq1
-ACGGCCAATTCCTCGTAGTTGTAGT
+ACGGCCAATT
 >seq2
 CTCAATCAGATCGATTGCAATGCACCATCGGG
->seq3
+>sequence3
 TGATGATGAAAGACAGCCGATGACATGGCGTACTACAGACGC

tests/test_SeqCollection.py

@@ -12,11 +12,17 @@ def test_SeqCollection():
         records=seq_records,
         projectname="EGF24",
         comments="This is a test sequence set.",
+        min_length=20,
+        max_length=40,
+        name_length=5,
     )
     assert seq_coll.n_seq == 3
-    assert seq_coll.n_bp == 99
+    assert seq_coll.n_bp == 84
     assert seq_coll.projectname == "EGF24"
-    assert seq_coll != ""
+    assert seq_coll.comments != ""
+    assert len(seq_coll.too_short) == 1
+    assert len(seq_coll.too_long) == 1
+    assert len(seq_coll.long_names) == 1
 
 
 def test_read_fasta():