Skip to content

A fast and sensitive gapped read aligner

License

Notifications You must be signed in to change notification settings

open-estuary/bowtie2

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Generic badge Build Status License: GPL v3

Overview

Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters, and particularly good at aligning to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 GB. Bowtie 2 supports gapped, local, and paired-end alignment modes.

Obtaining Bowtie2

Bowtie 2 is available from various package managers, notably Bioconda. With Bioconda installed, you should be able to install Bowtie 2 with conda install bowtie2.

Containerized versions of Bowtie 2 are also available via the Biocontainers project (e.g. via Docker Hub).

You can also download Bowtie 2 sources and binaries from the "releases" tab on this page. Binaries are available for the x86_64 architecture running Linux, Mac OS X, and Windows. We are planning on adding experimental support for ARM-64 in an upcoming release. If you plan to compile Bowtie 2 yourself, make sure you have the TBB and zlib libraries installed. See the Building from source section of the manual for details.

Getting started

Looking to try out Bowtie 2? Check out the Bowtie 2 UI (currently in beta).

Alignment

bowtie2 takes a Bowtie 2 index and a set of sequencing read files and outputs a set of alignments in SAM format.

"Alignment" is the process by which we discover how and where the read sequences are similar to the reference sequence. An “alignment” is a result from this process, specifically: an alignment is a way of “lining up” some or all of the characters in the read with some characters from the reference in a way that reveals how they’re similar. For example:

  Read:      GACTGGGCGATCTCGACTTCG
             |||||  |||||||||| |||
  Reference: GACTG--CGATCTCGACATCG

Where dash symbols represent gaps and vertical bars show where aligned characters match.

We use alignment to make an educated guess as to where a read originated with respect to the reference genome. It’s not always possible to determine this with certainty. For instance, if the reference genome contains several long stretches of As (AAAAAAAAA etc.) and the read sequence is a short stretch of As (AAAAAAA), we cannot know for certain exactly where in the sea of As the read originated.

Examples

# Aligning unpaired reads
bowtie2 -x example/index/lambda_virus -U example/reads/longreads.fq

# Aligning paired reads
bowtie2 -x example/index/lambda_virus -1 example/reads/reads_1.fq -2 example/reads/reads_2.fq

Building an index

bowtie2-build builds a Bowtie index from a set of DNA sequences. bowtie2-build outputs a set of 6 files with suffixes .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. In the case of a large index these suffixes will have a bt2l termination. These files together constitute the index: they are all that is needed to align reads to that reference. The original sequence FASTA files are no longer used by Bowtie 2 once the index is built.

Bowtie 2’s .bt2 index format is different from Bowtie 1’s .ebwt format, and they are not compatible with each other.

Examples

# Building a small index
bowtie2-build example/reference/lambda_virus.fa example/index/lambda_virus

# Building a large index
bowtie2-build --large-index example/reference/lambda_virus.fa example/index/lambda_virus

Index inpection

bowtie2-inspect extracts information from a Bowtie 2 index about what kind of index it is and what reference sequences were used to build it. When run without any options, the tool will output a FASTA file containing the sequences of the original references (with all non-A/C/G/T characters converted to Ns). It can also be used to extract just the reference sequence names using the -n/--names option or a more verbose summary using the -s/--summary option.

Examples

# Inspecting a lambda_virus index (small index) and outputting the summary
bowtie2-inspect --summary example/index/lambda_virus

# Inspecting the entire lambda virus index (large index)
bowtie2-inspect --large-index example/index/lambda_virus

Publications

Bowtie 2 Papers

Related Publications

Related Work

Check out the Bowtie 2 UI, a shiny, frontend to the Bowtie 2 command line.

About

A fast and sensitive gapped read aligner

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages

  • C++ 80.7%
  • Perl 14.5%
  • Python 1.5%
  • C 1.3%
  • Shell 1.1%
  • Makefile 0.6%
  • CMake 0.3%