Skip to content

Commit

Permalink
test: fix test case
Browse files Browse the repository at this point in the history
  • Loading branch information
JeremyWesthead committed Dec 5, 2024
1 parent ba1ebd0 commit efa358f
Showing 1 changed file with 1 addition and 1 deletion.
2 changes: 1 addition & 1 deletion tests/unit/test_unit.py
Original file line number Diff line number Diff line change
Expand Up @@ -2174,7 +2174,7 @@ def test_11():
"gene": "A",
"mutation": "-1_del_aaaaaaaaccccccccccgggggggggg",
"prediction": "U",
"evidence": {"row": 5},
"evidence": {"row": 4},
},
{
"gene": "A",
Expand Down

0 comments on commit efa358f

Please sign in to comment.