notebook 1: remove reference to generators and other minor fixes

sib-swiss · Mar 2, 2023 · 360ec31 · 360ec31
1 parent 7b60b42
commit 360ec31
Showing 1 changed file with 52 additions and 27 deletions.
diff --git a/notebooks/01_python_basics.ipynb b/notebooks/01_python_basics.ipynb
@@ -523,7 +523,9 @@
   {
    "cell_type": "code",
    "execution_count": null,
-   "metadata": {},
+   "metadata": {
+    "scrolled": true
+   },
    "outputs": [],
    "source": [
     "# Boolean\n",
@@ -849,7 +851,9 @@
   {
    "cell_type": "code",
    "execution_count": null,
-   "metadata": {},
+   "metadata": {
+    "scrolled": true
+   },
    "outputs": [],
    "source": [
     "gene_seq = \"ATGCGACTGATCGATCGATCGATCGATGATCGATCGATCGATGCTAGCTAC\"\n",
@@ -942,13 +946,15 @@
    "outputs": [],
    "source": [
     "print('Hello World')\n",
-    "print('Hello World\\n', sep=\"\")"
+    "print('Hello World\\n', end=\"\")"
    ]
   },
   {
    "cell_type": "markdown",
    "metadata": {},
    "source": [
+    "<br>\n",
+    "\n",
     "* **Combining** single and double quotes."
    ]
   },
@@ -1281,7 +1287,7 @@
    "cell_type": "markdown",
    "metadata": {},
    "source": [
-    "#### Creating lists and tuples from iterables (e.g. sequences such as lists/tuples, generators, range)\n",
+    "#### Creating lists and tuples from iterables (e.g. sequences such as lists/tuples, range)\n",
     "\n",
     "* Objects that are *iterables* can be converted to lists or tuples."
    ]
@@ -1297,7 +1303,7 @@
     "print(list_1)\n",
     "print(tuple_1)\n",
     "\n",
-    "# Creating a list/tuple from a \"generator\" type object.\n",
+    "# Creating a list/tuple from a \"range\" type object.\n",
     "list_1 = list(range(21))\n",
     "tuple_1 = tuple(range(21))\n",
     "print(list_1)\n",
@@ -1308,10 +1314,14 @@
    "cell_type": "markdown",
    "metadata": {},
    "source": [
-    "> What are **generators** ?  \n",
-    "> Generators are a type of objects that produce (generate) a sequence of items based.\n",
-    "> Unlike lists or tuples, the items in a sequence produced by a generator are not stored in memory, but\n",
-    "> generated *lazily* (i.e. \"on the fly\") at the time when they are needed."
+    "> What are **`range`** objects?  \n",
+    "> `range` objects are sequences of **integer numbers**, e.g. `0, 1, 2, 3, 4, ...`.\n",
+    ">\n",
+    "> By default, a call to `range(x)` creates a sequence of integers from `0` to `x`, `x` excluded.\n",
+    ">\n",
+    "> **Examples**:\n",
+    "> * `range(10`    -> `0, 1, 2, 3, 4, 5, 6, 7, 8, 9`\n",
+    "> * `range(3, 7)` -> `3, 4, 5, 6`"
    ]
   },
   {
@@ -1454,7 +1464,9 @@
    "cell_type": "markdown",
    "metadata": {},
    "source": [
-    "What can be done however, is to assign a new tuple to the same variable - this will *look* like we have modified a tuple, but in fact we have created a new tuple object and assigned it to our variable."
+    "<br>\n",
+    "\n",
+    "What can be done however, is to **assign a new tuple to the same variable** - this will *look* like we have modified a tuple, but in fact we have created a new tuple object and assigned it to our variable."
    ]
   },
   {
@@ -1463,8 +1475,11 @@
    "metadata": {},
    "outputs": [],
    "source": [
+    "my_tuple = (1 , 2 , 3 , 5)\n",
+    "print(my_tuple)\n",
+    "\n",
     "my_tuple = (1 , 2 , 3 , \"spam\")  # We do not modify an existing tuple: we create a new one.\n",
-    "print(my_tuple)"
+    "print(my_tuple)\n"
    ]
   },
   {
@@ -1473,7 +1488,7 @@
    "source": [
     "<br>\n",
     "\n",
-    "**Additional info**\n",
+    "### Additional info: tuples referencing mutable values\n",
     "\n",
     "* We just saw that **tuples are immutable**... but let's consider the following:"
    ]
@@ -1524,7 +1539,7 @@
     "\n",
     "### Copy of list content vs. copy of pointer (copying mutable values)\n",
     "\n",
-    "When assigning a **mutable** variable to another variable (as done below when assigning `l1` to `l2`), we are not duplicating the content of the existing variable: instead, we only create **a new pointer** to the content of the mutable variable."
+    "When assigning a variable to another variable (as done below when assigning `l1` to `l2`), we are not duplicating the content of the existing variable: instead, we only create **a new pointer** to the content of the original variable."
    ]
   },
   {
@@ -1886,7 +1901,7 @@
    "outputs": [],
    "source": [
     "quote = \"Drop your panties Sir William, I cannot wait till lunchtime.\"\n",
-    "individual_chars = list(my_string)\n",
+    "individual_chars = list(quote)\n",
     "\n",
     "print(individual_chars)"
    ]
@@ -1910,7 +1925,7 @@
    "outputs": [],
    "source": [
     "quote = \"Drop your panties Sir William, I cannot wait till lunchtime.\"\n",
-    "words = my_string.split()\n",
+    "words = quote.split()\n",
     "\n",
     "print(words)"
    ]
@@ -1933,8 +1948,15 @@
    "source": [
     "# Here, the separator calls the join method which accepts the list \"my_list\" as argument.\n",
     "quote = \" \".join(words) \n",
-    "print(quote)\n",
-    "\n",
+    "print(quote)"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
     "# One can use a more exotic separator - in fact, any string can be used as separator.\n",
     "quote = \"_SEP_\".join(words) \n",
     "print(quote)\n",
@@ -2016,18 +2038,21 @@
     "## Dictionaries <a id='26'></a>\n",
     "Dictionaries, or `dict`, are containers that associate a **key** to a **value**, just like a real world dictionary associates a word to its definition.\n",
     "* Dictionaries are instantiated with the `{key:value}` or `dict(key=value)` syntax.\n",
+    "\n",
+    "    ```python\n",
+    "    color_code = {'blue': 23, 'green': 45, 'red': 8}\n",
+    "    ```\n",
+    "  \n",
     "* **Keys** must be unique in the dictionary, and must be an immutable object (typically a `str`).\n",
     "* **Values** can appear as many time as desired in the dictionary.\n",
     "* The `[]` operator is used to **select objects from the dictionary**, but **using their key** instead\n",
-    "  of their index.\n",
-    "  ```python\n",
-    "  color_code = {'blue': 23, 'green': 45, 'red': 8}\n",
-    "  color_code['blue']   # returns 23\n",
-    "  color_code['red']    # returns 8\n",
-    "  ```\n",
-    "* Unlike lists or tuples, **dictionaries** are **unordered collections**: they do not record element position \n",
-    "  or order of insertion. Therefore values cannot be retrieved by index position. E.g. `color_code[0]` is not \n",
-    "  a valid syntax (and will raise a **`keyError`**), unless there is a key value of `0` in the dict.\n",
+    "  of their index. E.g. `color_code[0]` is not a valid syntax (and will raise a **`KeyError`**), unless\n",
+    "  there is a key value of `0` in the dict (which is not the case in our example).\n",
+    "  \n",
+    "    ```python\n",
+    "    color_code['blue']   # returns 23\n",
+    "    color_code['red']    # returns 8\n",
+    "    ``` \n",
     "* Dictionaries are **mutable** objects: `key:value` pairs can be added and removed, values can be modified."
    ]
   },
@@ -2067,7 +2092,7 @@
     "print(d[\"fox\"])\n",
     "\n",
     "key_value = \"penguin\"\n",
-    "print(f\"A {key_value} is a {d[key_value]}.\")"
+    "print(\"A\", key_value, \"is a\", d[key_value])"
    ]
   },
   {